Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24884  (registered. 2003)
Contig Information
Length 1484 bp
Clones 45 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 20
Wh_SHDr Shoot grown with dessication 12
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 3
Homology (BLAST) Top Hit BAX inhibitor 1 [Hordeum vulgare subsp. vulgare]
Score 1026
Evalue 2.72868e-109
Total Hit Count 277
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24884
ATCCATCCAAGCAGCGGAAGAAGAAGAAAAGGAAAAGAGAAAAATCCATCCGGAAGCGCGAGCAAAGGCCAAGGCAGCTTTGCGTGCGAGGCGAGGCGAG
GCCGCTCCGATTCGACAGACGCAGGGCAGGGATGGACGCCTTCTACTCGACCTCGTCGGCGGCGGCGAGCGGATGGGGCTACGACTCGCTCAAGAACTTC
CGCGAGATCTCCCCCGCCGCGCAGTCCCACCTCAAGCTCGTTTACCTGACCCTATGCTTTGCCCTGGCCTCATCTGCCGTGGGTGCTTACCTGCACATTG
CCCTGAACATCGGTGGGATGCTGACAATGCTTGCGTGTATCGGAACCATTGCCTGGATGTTCTCTGTGCCAGTCTATGAGGAGAGGAAGAGGTTTGGGCT
GCTGATGGGTGCAGCCCTCCTGGAAGGGGCTTCGGTTGGACCTCTGATTGAGCTTGCCATAGACTTTGACCCAAGCATCCTCGTGACAGGGTTTGTTGGA
ACCGCCATCGCCTTTGGGTGCTTCTCTGGCGCCGCCATCATCGCCAAGCGCAGGGAGTACCTGTACCTCGGTGGCCTGCTCTCCTCCGGCCTGTCGATCC
TGCTCTGGCTGCAGTTTGCCACGTCCATCTTTGGCCACTCCTCTGGCAGCTTCATGTTTGAGGTTTACTTTGGCCTGTTGATCTTTCTGGGATACATGGT
GTACGACACGCAGGAGATCATCGAGAGGGCGCACCACGGCGACATGGACTACATCAAGCACGCGCTCACCCTCTTCACCGACTTTGTCGCCGTCCTCGTC
CGGATCCTCATCATCATGCTCAAGAACGCAGGCGACAAGTCGGAGGACAAGAAGAAGAGGAAGAGGAGGTCCTGAACGTGTTGTCCTCTGCACATCGTAG
ATACCATCACCGCCGCCGCCGCTACTGGTACCACCTCCACTGCTAAGTACTTGTAGGAATTAAGCTGGCGCAGTAACTTGTCGCCGTGCCACCCTTGTTA
ATTCGCGATCTGTGTCGTGTGAACCCTTGTGTGAGTTTGCTGCTGCTGATGAAGCTTTTGCAGACGCTGTCTGCGTTCCGGATCTCTTGCGTTCCTGTTA
CTGTCTCGATAATCGAAACCTGAGACGATTTGGTTTGGTTGCGAAGAACATGGCTACGCTCGATTGTGGCTCGTTGGTTTTAACCTTGTGATGTGTCTCA
TTTCTTTTGAACAAATTGTCCAACACATGTTGGTACTGCAGGTTGTTGAGCAAGGCCTGTCCGATTGTGATGTTCACCTGTGCTCTTCTCTTGTCGTGTT
TCCAGGTAGTTGGCTCGACTGGCACATCCAACTTGCCCTGGACCTGCCGCCGCGTTTCGGCCAGGCATCTGATAGTAGAGCTGTAAAACTAGTTTTTCCC
CAACGTGGTTGCCGCGTCCGCCAGTTTTAGGGCGTGTTTGGTTGCAATANTGAACAATTTGTTTCGTTGTCTGTAAAAAAAAAA
page-top