Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24833  (registered. 2003)
Contig Information
Length 1098 bp
Clones 43 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_OKCS Seed DPA5 8
Wh_SHC Shoot grown with cold treatment 6
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 4
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit seed maturation protein [Zea mays]
Score 1023
Evalue 3.97862e-109
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24833
AAGAAAAGCTCGGGAGGAGAGCGTGGGGGGACTAGGGAGCATGGCGGAGCACAAGGAGGAGCCGGTGGCGGAGTCCATGATGGACAAGATCTCCGACAAG
TTCCACGGTGGGGACTCGTCGTCGTCGTCCTCGGACTCGGACGACGAGAAGAAGGGGTCGGCGGCGGGCGTCAAGGCCAAGATCTACCGCCTCTTCGGCC
GCGAGAAGCCCGTCCACGCCGTCCTCGGCGGCGGCAAGCCTGCTGATCTTGTTCTATGGAGGAACAAGAAGGTCTCCGGAGGGGTGCTTGCTGGCGCTAC
TGCCATCTGGCTGCTGTTCGAGGTCATGGAGTACCATCTGCTCACCTTGGTGGGCCACTGCCTCATCCTCTCCCTGGCAACCCTCTTCCTCTATTCCAAT
GTCTGCATTTTCATCCACAAGTCTCCCCCGAACATCCCTGAGGTGAAAATCCCGGAGGACATGACTGTAAACATTGCACTATCACTGCGGCATGAGATCA
ACCGGGGCTTCTTTACCTTGAGAGAGACTGGTCATGGTCGTGATCTGAAGAAATTCCTCATTGTGATTGGAGGGCTCTGGCTTCTTTCTGTTCTTGGGAG
CTACTGCAACTTTTTGACACTGTCATATATAGTCTTTGTGGTGCTGTACACTGTGCCAGTTCTGTATGAGAAGTACGATGACAAGGTGGATGCTTTTGGT
GAGAAGGCCATGATCGAATTGAAGAAGTATTATGCCATCTTTGAAGAGAAGGTCCTGTCGAAGATCCCGAAGAACAAGAAGCACTAGATCACAAGAGTTA
CCCTGCCGCGTATTGCCATCTGTGTTAATCTCAACTTGTTGCCTCATTTTGAAGGATGGTTCTGTGTCATTGCGTCTGTCTTTAGTTAATACTACTTGAT
ACTAGTACATATAGATGTGGTGTGCTAATCCTTTTGTGAAGTGGAGTCATGCCAGCTGAAGATTGTTGATCTTCTTTTTTTTGTTTATTTTTCAACTTTC
AGCATGGTTACTCTATCTGGGAGCCGGAAATGTTATGGCATTACCTGTTCTAGTGCCTAGTGATATACTACTGCGTAGTGATTTATCCAAAAAAAAAA
page-top