Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24829  (registered. 2003)
Contig Information
Length 906 bp
Clones 43 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 8
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 9
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 6
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit ribosomal protein L15 [Homo sapiens]
Score 841
Evalue 3.72281e-88
Total Hit Count 392
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24829
TCCCCTCCCGCCGCCTCCGCACTGTGCCGCCGCAGCCGCAGCCATGGGCGCGTACAAGTTCGTGTCGGAGCTATGGAGGAGGAAGCAGTCGGACGTGATG
AGGTTCGTGCAGCGCGTGCGTTGCTGGGAGTACAGGCAGCAGCCGGCCATCGTGCGCATCACCAGGCCCACCCGCCCCGACAGGGCACGCCGTCTCGGCT
TCAAGGCCAAGCAGGGGTATGTGGTCTACCGTATCCGTGTCAGGCGTGGTGGCAGGAAGAGGCCAGTGCCCAAGGGTATTGTCTATGGTAAGCCCAAGCA
CCAGGGTATTACCCAGCTCAAGTTCCAGAGGAACAAGAGGTCTGTTGCTGAAGAAAGAGCTGGGCGCAGGCTGGGTGGTCTTCGTGTGCTCAACTCCTAC
TGGGTGAATGAGGACTCTACCTACAAGTACTTTGAGGTCATCCTTGTTGATGTTGCTCACAGTGCTGTCCGCAACGACCCAAGGATCAACTGGCTCTGCA
AGCCTGTGCACAAGCACCGTGAGCTTCGCGGACTCACGTCAGCCGGAAAGAAATTCCGTGGTCTGCGTGGCAAGGGCCACCGCCACCACAAGAACAGGCC
CTCGAGGAGAGCCACCTGGAAGCGCAACCAGACCGTCTCCCTCCGCCGCTACCGTTAAGCTGCCCCATGCACACCTTGATAGTATTCGTTTGAACCATCA
GATTTTGCTACCTTTGTTCGGAAACTCCTTGAAGCTCGTGCTAGAACCTTTATGTCGAGGCAATATCTGTTGAACTATTTGCTATTTGCCTGTGTTACCA
GAACAAGGATTGAATTAGTAATCGTATGCTGTGTGCTATGGTGTCATATGTTTGGTGGTTTACCTTATAATGTTATGATGTTTTTCATCTCTTTACAAAA
AAAAAA
page-top