Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24814  (registered. 2003)
Contig Information
Length 1174 bp
Clones 42 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 8
Wh_EM Dormant seed with water absorption 4
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 20
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHC Shoot grown with cold treatment 4
Homology (BLAST) Top Hit chitinase IV precursor [Triticum aestivum]
Score 849
Evalue 6.59315e-89
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24814
TCAATAATGTTACCTCCGTCATGAATTACTCGTATTAGATTTTTTTAGATACAGATGTACCTAGACATGAGTAATAAACAAGAACATAGGAGTAACACTT
TTTGCTTGTTGATGAGGAAAAGGAGTAGAGCTCGTGAGCAGTACTACTGCAAGGATCTTGGTACGTGCTAGACCACATCCTCACCCTTTATTTCTTGTTT
GGACGGCTTAAGACGCGTATACGCATGCCGAACGTTTATTCTACATAAGTCATGCATGTTCTCTGCATGCCCATCTCGATCAGGCGCAAAGCACCTAGCA
AGTGAGGCTGCTCCCCGGGTCGACGCCGAACTGCCTGCAGTAGGCCCTGTAGTAGCCCGCCCGGGCGTTCATGGCGGCCGCGTTCCCGCCGTTGCACTCG
CCGCTGTTGATCGCCCTGGTCGTCGCGCCGAATCCCCGCGGCAGGACCTGCTTCACGTTGTTCATCCAGAACCAGAGCGCCGCCTTGAAGGCCACCTCCG
GGTCCTGCGCCACCTTCTCCGGGTTTTTGAGCCCGTCGAACCCCACGCTCTTCCCCGCCGCCCCGTAGTTGTAGTTCCACGTCAGCTGCAGCGGCCCACG
CCCGTAGTACCCCTTCCCCGAGGCGCACGGCCACTGCGTGTACTTCCTGTCGCAGTAGTTCTGCCTCGCCCCGCCGATCTCCTCGATGTAGCACATGTGT
CCGGTCTCGTGGGTGACGTGGGCGAAGAAGGCGGCTATCTCCCTCTTGCCGTCGTCGCTGGTGCTGCCTTTCCCGAAGTTGGGGTTGGCCCGGGCGCCGG
CCAGGAACGACCGGCGCGTGTAAAAGCTCTTGCCGGCGCACCCGTTGCCGGCCCGGGACTTGATCCCGTTGAAGAACGCCTTGGTGACGACGCTCTCCAC
GGAGACGCCGCTCCCGCCGCCGCCACCACCGCTCGCCGTGCACGGGCCGGACTGGCATCCTTTTCCACAGTAGGCGTCGGTAGTGCCGCAGTAGCCGTAC
TGGCTGCAGCACTCGTTCGCCCGGCAGCCGCACTTCTGCGCGGCCACCATTCCCGCGGCAGACAGGACTAGTGCTGCTACCCCGAGTGCCAGGAACGGGA
GCATCGCCATGGGCGACCTCGCCATTTCGAAATAAGGTTAACGGTGGCCAAACTTGTTCCGCTCTAGCAAAGCT
page-top