Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7824  (registered. 2012)
Contig Information
Length 893 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_KMP Shoot grown under continuous light 1
Wh_VSCB Liquid cultured tissue 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226505162|ref|NP_001149822.1|| beta alanine synthase1 [Zea mays]
Score 494
Evalue 5.00E-138
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7824
TTTTTTTTTTAAAAGAGTGAATATGTAGATTTCAACATTGGGTAAAGTCAGACCATGGAAACTTGATCAAAAGGTGTTTACTGATTTATTTTTATATTTA
TACAACATATACAGAAAAGAAGGGAAAGGGCATCGACTTCGTCTGCTTAGACCCAATTGATTCAAAATTAAGCCCTCTTATTTATCAAGGGATCCGCGAT
GATCTGAGGCTTAAAATCTGGCTTCAAGTACTCTGAAAGCAAGTCAGCATACATGTCATACCGAGCAGTCATGCGGAAGGCCCACTTGTCTTTGATCTGG
CGGCATAAGTTCAGGTCCATGTCAGATATCATCAAGCCATCTCGGTAGCGCGATAGCGATGGGGTGCAGGAAGCATCAGGCGCTGAGAAATGGCTGGATC
CATAGAAATGACCAAAGTCGGCATGCTGAGGTTTCCCATCACCAGAAGTGAATGGGTTCGGGAATACCTCTGTGCCTACCCGGTTAATTGATCCGACAAA
GTAGCTATTTGCAATTGCAGCATTCCTTGCCTCAATAGGCCACATTGGTTCACTAAGTTCACCGACAGTTGCAGATGGGTTGAAAACTATTTCAGCTCCA
TTGAGGCCAAATGCAAGCCAATTCAGAGGATGATGCCTGCCGTAGCAGATGTTTACAGCAATTTTGCCATAAGCTGTTTCAAACACCGGATGCCCAGTGT
TACCTTCCATATAGTACGTGCTCTCATTGAAGTCGCCAACTCTTGGGATGTGATTCTTTCGATGAATGCCAATTATGTTGCCATTATTTCCAATTACAAC
AACAGTATTCCATATAGTCTCTCCATGGTTTATATCCCTTTCAAGGATAGGGCTAACAATTACCATGTTATATTTCTGTGCAAGCTCTTGAAG
page-top