Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24806  (registered. 2003)
Contig Information
Length 1230 bp
Clones 41 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 6
Wh_V4816 Shoot grown under cold condition for 16days 7
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 10
Homology (BLAST) Top Hit chloroplast oxygen-evolving enhancer protein 1 [Leymus chinensis]
Score 1640
Evalue 1.34502e-180
Total Hit Count 196
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24806
CAACAAAGAATTTTGTGAACATTCATGGGGGATCAATATCATGAGTTGGCGAGGAAGAAACAATAATAACAGAAGCTAAAATATAAACCGACACCCTGGG
TTTAGATTACTAGATACACACACAAACACATTTGTTGCCTCGATTGTTTCCTCTCCACCGATCAACCCACGTACGCATGCACACAAGATGAGTATCTTCA
CTTCTGCTCTGCTCTAGTTAGACTCGAGCTGCGCGTACCACACACCCTGGATCTTGACATCCTTGGGCGCCTTGGCGCCGAGGTCGGTGTCTGACGGCTG
CACGCTCTCGAAGACACCGATCACCTCGCCGGTCTCCGGCTTGCTCTTGGTCACGCTGAGCGTGATGTTGCCCGTGGACGAGGACGCGTTCTTCACGTTC
TCCTTAGCCAACTCCTCCTCGTCTCCTCTGCCTCCGGCGGGTAGCGCCACGGCGTTGTCGTAGCCAGTAGAGCCACCACGGCCCTTTGGGTCGAGGAAAG
ACGAACCCCTGTAGCTGGGCACGAGGAAGGGCCCGCTGAAGCTCTCGGGCTTGCCGGTAGCGACGAGCTGCTTGACGGTGAAGAGGAAGGGCACTCGCTC
GCCTCCGGGGAGCTGCACGGTGACGGCCGCGTAGTCGATGCCGTCCTTCTCCTCGAACTTGAGGGTGCCGTCGGCGCCGACCTCGAGCGGGCCTTCCATC
TCGTCAAGGGTGTAGGTGAGACGGGTCATGAGCTTGGTTTTCTGGAAGGCCGGCGGCTCGTTCTTCTGGATGCCCTCGGCCTTGACGGTGAAGGAGGTGG
GCTCCAGGCAGAACTTCTTCATCTCGTACTTGCCGGCCTTGAAGGGGAAGGAGTCGACGCCGCCGTCGATGGTCGGGCACTGGTTCGCGGTGCCGGTACC
CTTCACCTCCATGTAGGTCTTGCTCTGGATCTCGTCGAAGGTCAGCCTCTTGGGCGCCCCCTCCGCGCTCGCGCCGGAGACGAGGAGGGCAGAGGTGGCG
AGGGCGAAGCCGGCCATCTTGGCGGCGTCGGCGCACTTGCTTGCGACCTCCCTGATGTCGGACTGCAGGGAGCAGGTGATCCTGGCGCCAGNGTCAACGC
CGAACGCCCGGGCGACGTGCGACGACGGCCGCGCGGAGGAGGCCCGGCCGCCGATCTTGGCCGGCATCAGCGTGGCCGCGGCTTGGAGAGACCGCTGCCA
TGTTGGTCGGTGGCTNGGATCGCGGGAGGA
page-top