Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24805  (registered. 2003)
Contig Information
Length 1231 bp
Clones 41 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_KMP Shoot grown under continuous light 10
Wh_KMV Shoot grown with continuous light after cold treatment 9
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 10
Wh_VWD Shoot grown with dessication 3
Homology (BLAST) Top Hit hypothetical protein OsI_15903 [Oryza sativa Indica Group]
Score 352
Evalue 3.02598e-31
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24805
ATTCATGCAGAAACAATACATACAACAATACATGCGTAGACACGCAGCAAGTTAAATACATATTCCACACTTTGTGCTACTTTGATATGCTTTAATAAGA
TGGTTGCATGCATCATTATGATGCAGAGGGCCGAGGGTACACCTCCATTTTCAAAAAGAAAAAACATGCACGCAGGGCGCAGCAGCAACACAGGCACACC
GGATGTTAAAAAAAAACAGGCACACCGGCCAAACGTACGTAGTACGTATACATAACGAGCCGTATATACGCACAAATTCCTGGCTCTTATTGGACGCACG
CTCGCGCGTATGCGTATAGGTGTGCTAGCAGCTGGCTGAATCGCGGATCGATCAGCAGCAGCTGGCTAGCTTAGCCGAAGAAGTGGTGCTTCTTCTTCCC
CTCGCCGCGGCCGGACTCCTCGTCCTCGCCGTCCTCTGCCGACTCCTTGTACTCCTTCTTCTCGTGGTGCTCGTGGAACGCGTAACCGCCGCTGCCCACG
GCCGCCACCGCGGCCACCTCCTCCTCGATCTTGTGTCGGTGCGCGTTCTCCGGGTCCTTCTTCACCTGGTGCTTCTCGTACATGGCGAAGGCGCCGGAGG
CGAGGGTGCCTATCTCGCCGAGGTGCTCCTTGTGCTTGTGCTCCTTCTCCTCCTTCCTGTACTTCTCGGTCTCGTCCCTGGACGACCCGTACTCTGTGTC
GTCGCCGCCGGACTTCTTGTACCCGCCGCCGCTGTACTCGTCGTCGCCCCCCGACTTCTTGTACCCGCCACCGCTGTACTCGTCGTCGCCACCCGCCTTC
TTGTACCCGCCACCGCTGTACTCATCGTCGCCGGACTTCTTGTACCCGCCGGCGCTGCGGTCGTAGTCGTCGCTGCCGGGCTTGTTGCGGCCGTACTCCT
CGTTGCTGGACTGCTTGTTGTAACCGGTGTCGTAGTTGTCGCCTCCGGACTTCTTGTACCCGGCGCCGCTGTACTCGTCGTCGCCGGTGGACTTGTTGTA
GCCACCGCGGCCGCTGCTGCGCTCGTGCTCGTAGTCGTCGGCGCCGGACTTGTTGTAGCCACCTTCTCGGCGGTCGTAGCCCTCGTTGCTGGTCTTGTTG
TCGTAGTCGTCGCCGGCAGCGGACCTGCCGTAGCCGCCGCGGCCGTACTCGTCAGCCATCTCGTTCGAGTGTGGGACTACGGGAGAGAAACAAACTTGTC
ACGGGCTCACGGCTCACTAGTTTAGAGCGGC
page-top