Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7823  (registered. 2012)
Contig Information
Length 1284 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 1
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242058253|ref|XP_002458272.1|| hypothetical protein SORBIDRAFT_03g030400 [Sorghum bicolor]
Score 558
Evalue 5.00E-157
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7823
GAGTAATATCCTTGGGGAGGGCGGCTATGGAGTTGTCTACAAAGGCCGGCTTATGAATGGGACTGAGGTGGCTGTGAAGAAGATCCTAAACAATGTAGGG
CAAGCAGAGAAGGAATTTAGAGTTGAAGTTGAAGCCATAGGTCATGTTCGGCATAAGAATCTGGTGCGGCTTTTGGGCTACTGCGTTGAAGGGATACACA
GGATGCTTGTGTATGAGTATGTAAACAATGGCAACCTAGAACAATGGCTCCATGGGGCCATGGGTCAACATGGTATCCTTAGTTGGGAAAGCCGTACGAA
GATTCTGCTTGGGACAGCAAAAGCGCTTGCATACCTTCACGAAGCAATAGACCCCAAAGTCGTCCACCGAGATATCAAGTCAAGTAATATCTTAATTGAT
ACCGAATTCAACAGCAAGGTTTCTGATTTTGGGTTAGCGAAACTTCTGGATTCCGACGCAAGCCATATCAATACAAGAGTGATGGGAACATATGGGTATG
TCGCGCCTGAGTACGCGAATAGTGGGATGCTGAATGAAAAGAGTGATATTTACAGTTTTGGAGTTGTGTTGTTGGAATGCATTACAGCTAGGGATCCAGT
TGACTACAGTAAGCCTGCAGATGAGTCAAACCTTGTGGAGTGGCTTAAAATGATGGTTAGCACAAAGAGGGCAGAGGAGGTTGTGGACCCAGGCCTTGAG
GTTAAACCACCTAAGCGTGCCCTTAAGCGGGCAATTTTGGTTGGCCTCAAGTGTGTTGATCCTGACGCCGACAAGAGGCCGAAGATGAGCCATGTTGTCC
AAATGCTTGAAGCGGTCCAGAAAGCATACCAAGAAGATGAGAAGAAGCACAGCCAGATGGGAAGCATCGATCTAGAGTCGCAGCAGTCAGTAGAGGAGCT
ATCAAACAGTGCTGATGTCTGAAGCTCCAGTTGTGAACAAACCCAAAAGAAATAGGAAACCTTAAGTTATTTGATAGTGACAGCTGATTTGATCAAACAT
GTTCAATACTTGAGTAGAGTGAGTGAAACAGGTTTGCAATTTGCTTGCAGATACCGAGGTTGTTGAATTCAGTTAGGTGCAAGCTGCTTGTTTCCGTGTT
TTTTTTCCTTTTTGTGGTTTCCGAGGATTGCTTCTATGCTCCCCTGAAAGAGTTGCCTTACTGTTTGTTTTCTGTGGATGAGTCCTATAACTCGTTTGCT
TTAGTGTTTTGTCTAGTCTTCTTCTAGGGGAGCATAGAAGCAAGCACTCTCTTCGTCTTGAGTTATTGTCAGTGTCTCAGTGAG
page-top