Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24798  (registered. 2003)
Contig Information
Length 842 bp
Clones 41 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 5
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 7
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit DNA-directed RNA polymerases I, II, and III 14.4 kDa polypeptide [Zea mays]
Score 495
Evalue 4.35036e-48
Total Hit Count 229
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24798
CATCTCTAGGCTACACTGAGATAGAAATGCGAACACTGAATAATCAGCAGAACGTCCTGCACCACGCTCACAAAAGGAGGTTAGAGTAGGGTATTCATTC
GCAACTTGTAGCTGCATGCAAGCAATGGTCCAAGCAAACTAACGCAACCACGCAATTGGTTTACAGTAGTAGCACAACACAATGGGCAGACATAGCCCAC
ACATGTTACGGTAACATAACATTGTCGCGGCAGTTCAGTGCCAAAGATTGCATATAGCTACTAGGGCAAAGTTTAGTTGCAGCACGGAGCCTCCCATTCG
AACAGTCTACCAGCTCTAGTCCCCGCCAACCTGACGCTTCCACGAGTCCTCCACAATGAGCTCGTCAACTCCCCAGTCCTCGTAGCTTCCATCAGGTAAG
TAGCGCCTAATCGTGAAGGGGATCTTACGTGCTCTCAGTTCTTTCATGGCAATCTCAAGAGGATCAGTTTCACCCTCAAGCTCAACCATAACTGGGGCAT
TCATGCTTATCTGCAAAGCACGTGTGCCAAGGATGCGTGCCCGCTCATACTTGGTCATATATTTTGTTGTATTGCGTGGACGGGCAGTCTTTTCCTGTTC
CTTTTCTTCACCTTCACCCCCTACCACGTCATCAGGGGCATCCTCGTTGTTCTCAGGATCTTCTTCAACCCCTTCCTCAATATCAGCCTCTGGAGGCTCA
TCCTCGTACCCCATGTCAACTTCATTATAGTCGTCGTCCGCCATGGCTGCCGCCGCCGAGCGCTCCGGTCGCTAGGGTTTCGCCGCGGGAGGAAGCCTCG
GGCGTGGGGATTGTGGTGGGTGTTCGCCGACAGGGAAAGGGC
page-top