Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7822  (registered. 2012)
Contig Information
Length 1370 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_r Root 1
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125559909|gb|EAZ05357.1|| hypothetical protein OsI_27561 [Oryza sativa Indica Group]
Score 654
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7822
TTTTTTTTTTAAGCTAACCAGGTTCTCTTTTCAACTCAAGAAGTTCAAAGTTAACATAACAATCTACTAGTACTACAGAGAGTAAACTTTTAGAAGGCAA
GCCTGGCGGAACATCGCAAAGATTTAAAGCAGCAGGTGACAAAACATATATAGCTTTCAAATATATCTTGCTGTCAGCAGGGCTTTGGAACAGAAGTCAG
GCAGTCCACTGCCCGCCGTATCCAGCAGCAGCAGCAGGCTGAGGTGACACGCCCTTTGCAACCGCAGGCTGTGGGTTTGCAGCAGGTGCAGCATAGCCAC
TTTGAGCTGCTGGTGGCGCAGACTGATCATAACTTGGTGGGTTTGTAGCTGGTGGCTGAGTGTATCCTGCCTGACCATATCCAGGCTGACCAGTTGTCGG
TGCAGCAGCATATCCTGACTGTGGGTAGGCATTTCCATAGTTGGGATCAGCTGGGGCTCCCTGATAACCATAGTTTGCATTGTTTTGAGCTGACTGATCA
CCGTATGCTGGCTGTGATGCAGGATACTGCGCATAGCCGCCTTGTTGACTGTACCCTGGTCCTGCCGGAGCACTCTGACCATATGCTGCTGGCCCTTGCC
CTTGCCCACCCTGCTGTGAATAACCCTGCTGAGCATACCCATCAGGTCCAGTTGGGTATGTTTGACCATAAGCAGGAGGTTGCTGGGCTGGCGGAGCATA
AGATGCAGGCGGTGGTGCCTGGTAAGCACCATCTGCAGGTGCACTGCCTCTGGGTGGCCATTGTCCAGGTCCACCATATGGAGGTCTAGCATAAGGATCT
GGCTGTTGAGGGTAGCCTTGCTGCGGACCGGCTGGTGGCTGCCCATAGTACTGCTGGGCTGGAGCTGGAGCACTGTACCTAGGATCACCATATCCAGGGC
CATAGTTCTGTGGAGGTGCAGACTGCGGATACTGAGGCTGTCCATAGCTTGGAGCTTGTGATGGGCCATAGCTGTTGAAGTTACCTGGTCCAGGGGGGTA
GTTTGGTGGCTGGCTTTCATAAGGTTGAGATCCCTGTTTGTAGTAGTCATAACCACCACCCTGGTGAGGCGGAGGGCCCTGCCTCTGGTCCCAGCCCATG
CCACCTCTTGGTGGTGGCTGCTGTGGGTAACCACCATAAGGGGGTTGAGAGTATGGCGCGTTCTGAGGAGGCCCTCTTGGTGGATATCCATACTGCTGAG
GTTGAGACCGTGGCCCCCACTGAGAAGCTGGGCCATGACCCTGAGGGTTGTGATGTTGCGGACCATAGCCACCAGACTGAGTTGTGTTTCTTGGAAATGT
CTAGACATGGTGATGCAGTATCCTTGGCATGGCAATGATACAATTGGTGCAGTCTTCCAATGCAGGATTG
page-top