Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7821  (registered. 2012)
Contig Information
Length 552 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 2
Wh_VSCB Liquid cultured tissue 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XV Leaves, plant was grown at constant 23℃ 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig7821
TTTTTTTTTTGAAGAAACATGGGATAGTAGTATACTGTAGACAGCAAAGAAGGTGCTACACAAATCACCATATAGAAGTGGATTCCAAAACCACGAGTGG
TCCACGAGAACAGATCACAAGATAAATCTCCTAATTTTAATTTATCATTCCAGGCATGCAGTTCAGATATATAGGAACTTCAAACACAGTACTGGATACT
TGGATGGTTTTCAGAACGACCAGACAAATGTTCACACCACTCATTTTAACATAGGAGTCACATGATTGGCAGCTAGGCCTTGCAGGCACCCGACTGTCCA
GACAACGCTCATTCGTTCATTACAGGCTTGTTCTCGTTGGCCTTGAACCTCTGGTCCTTCGGCTTCTGCTCTTCCATTTTCCTCTTGTCGGAGGACGCGC
CGCCCTTCTGGCTGAGGAAGGAGCGGAACAGTGGGGAGTTCACGTCGTAGATCATCTTCCTTCTTCTTCTCTTCTTCTTCGCTGCCGCTGCCGCCGCCGC
CGATGGGGAGAGCCTAGCTAGGGTTCGTGGGAGAGGGTGAGACGCCTCGTGC
page-top