Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24778  (registered. 2003)
Contig Information
Length 816 bp
Clones 40 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_EM Dormant seed with water absorption 7
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 3
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit retrotransposon protein, putative, Ty1-copia subclass [Oryza sativa (japonica cultivar-group)]
Score 663
Evalue 1.35012e-67
Total Hit Count 351
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24778
TTTTTTTTTTACGACAGGCCAATCACTAACATCACATTCACGCAAGGAGTAAAATCCATCTTTATGACAAGAACTCACAAGCATAAGATTCTCCCAGGCG
GGCAGATAATTTAAAAGCTCAGACAATAACCATTGTACCAGAATAGCATGCGATCTACTTCAACGAAGTCTTGGATAACAAACACAGGGGGGTATCATAA
TTCAAAACTGTAGCCAAATTCTACTACCGAACACGATTGCATAGAGGGGACTTCAACTGATCAGAATTCGGCAGGAACAGTTCCTGCAACCTGGTCCAGA
TCACGCCTTCCCTGGGAGGTGATGAGCCTTCCACCCTTGGGGTCCACATCAATGATGCCCATCTTCTGCAACTCCTGGAGGATGTTGCGGGACACAGCAC
CACTGCTCTTGCAGAAGTGCGGTGGGCGTGAACCATTCCTCTGACGGCCACCGTAGATCTTCTGGAAGCCGCCGATCCCAATTCCCTGCCTCAGGTAGAT
CTTCCTTGCCATCGAGGCAGCCCTGATGTAGTACCAGTCAGCATCAGAAGGTGGAAGCTCCTTGAACCTTGCAGTCTTGACAATGTCAACCCACTCCGGA
AGCTCCATCTTGCCGGAGCGCTTGAGGTGCGCGGAGTAGGCCTTGACGAACTCGTGGGGGTTGACATCCTTCACCGTGCGCGCCGTGGAGGCCGCGGTCT
CGGCTGCGGGAGCGGGCACGGTCGCCATCCTGTGCTCTCGCCGACGGCGGCGCTGTCTTCAGGGAGGAGGGAGAGGTGTGCGCGCCGCTGCGGCTGCGAG
GGCTAGGGTTTTTCTG
page-top