Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7820  (registered. 2012)
Contig Information
Length 877 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_CSEC Callus 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_VSCB Liquid cultured tissue 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226498912|ref|NP_001150650.1|| serologically defined breast cancer antigen NY-BR-84 [Zea mays]
Score 489
Evalue 2.00E-136
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7820
TGCAGAAACACCCTCTCCACTTTGTCGCGGCGGCGACGGCGAGGGCGACAACGCAGATCTCCTCTCGTCCTAAGGCTCCGGCGATCTCTCTGGCTGTGTG
AGCGGGAGAGATGGAGCTGTGGAGCAAGCTGAGGAGCCTCGACGCCTACCCCAAGGTGAACGAGGACTTCTACAGCCGCACCCTCTCCGGCGGACTCATC
ACCATCGTCTCCTCCCTCGCTATCCTCCTCCTCTTCTTCTCAGAGATCCGGTTGTATCTATATGCTGCTACAGAGAGTAAGCTCACAGTTGATACCTCAA
GAGGGGAAAGGTTACATATCAATTTTGATGTTACATTCCCCGCTCTTCCCTGTTCTCTTGTTGCTATTGATACTATGGATGTTAGTGGAGAGCAACATTA
TGATATAAGACATGACATAATGAAGAAAAGAATTGATCATCTTGGTAATGTAATTGAATCGAGAAAAGATGGAGTTGGTTCCCCTAAGATTGAAAGACCA
TTGCAGAATCATGGTGGAAGGCTTGACCACAATGAGGTTTACTGTGGGTCTTGTTATGGTTCCGAAGAGTCAGATGACCAGTGTTGTAACTCCTGTGAAG
AAGTTCGTGATTCCTATCGGAAGAAAGGTTGGGCACTCACTAACGTAGAATCAATTGATCAGTGCAAGAGAGAGGGCTTCGTTCAAAGGTTAAAAGATGA
ACAAGGCGAAGGTTGCAACATTCATGGGTTTGTAGATGTCAATAAAGTTGCTGGAAATTTTCACTTTGCCCCAGGAAAAAGCTTNNACCATGCATTCAAC
TTCCTTCAAGATATGTTGAACTTCCAGCCNNNNNNNTACAATATAAGCCACAAGATAAACAAACTGTCCTTTGGGAA
page-top