Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24765  (registered. 2003)
Contig Information
Length 1005 bp
Clones 40 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 3
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_OKCS Seed DPA5 4
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 5
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 7
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 8
Homology (BLAST) Top Hit glutathione S-transferase 2 [Oryza sativa (japonica cultivar-group)] >gi|218190996|gb|EEC73423.1| hypothetical protein OsI_07693 [Oryza sativa Indica Group]
Score 979
Evalue 4.41671e-104
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24765
TTTTTTTTTTGAAATGTAAGCCACTGATGTTTCATCTTGTTGCTATTTCACGTAAGTCCAGAATTCCAGATATCCAAAGGCTAGTGATCACAATTATTTC
ACTGTTTTGATACAGACTACAGTAGTTACTTTACACTTGGTGCAGGAAGTTCTGTGCTTATTGTTACAGAGTTTGAAGTAACGGGACAGGACACACACAG
GTACAGACAAAGCAGTGAGAACTACTGATTCACTCCCGGCCTATGTCTAGGCAGAGGAAGGGGCATCCGGCTGCCGGTCAGGGAGCGCAGCTTCAAATGC
AGGGTGTGTCATATATTGATCGTAGAGCCTCGCGAGGGTGGGATAGTTCGACATGTCGATTTGATAACGAGTCACCGCAGCAAAAATCTGGGGTGCAAGG
AATACATCTGCCAGTTGGACTTCATCTCCCATAGCAAACTTCCCAGCACAGCCTTTGATCATGTTCTCAACAGCTGTGAAACCTCTATCAATCTGTTGTT
TGACCCACGGGATGCTCTCCCCTGTTCCAACTTTTTGCTCGATAAATCTCACCAAGGTGAGATTGTGAAGAGGTTGAATACCAGAACACACAATGCTTGC
TATCTGGATATTCAGGGCCTTCTTTTTAAGGTCTTGGGGCAAAAGAGGGCGCTGAGGGTACTTGTCCTCCAAATACAATGCTATTGCGTAAGAGTCGCCG
ATTACTGCGTCGCCGTCGACCAAGGCAGGGACGAACTTCATAGGATTAAGCTTCATGAACTCAGGATCAGACTGCTCGCCCTTGAGGAGGTTCACCGCCT
TGTACTCATAATCGATACCTTTGAGGTTGAGCGCGATGCGGACGCGGTGGGAGCAGGAGCTGCGCCAGTACGAGTAGAGAATCGGCCTTGCCGTCGGAGC
CTCCGCCGAAGCCATTCGGAGCTAGCAGCAGCTCGGTCTCGGAGGCGCGGATTCGTGGGCCGGCGGCCAGGGAAGAAGTGGACCACGGCAGCGCTCGGTC
GAGCC
page-top