Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7819  (registered. 2012)
Contig Information
Length 776 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|51477447|gb|AAU04631.1|| CENP-C [Triticum aestivum]
Score 173
Evalue 2.00E-41
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7819
TCTTTTCATTCTCTTCAATGGCTGCTTCTTAGACTNNTCATTTTGAACTCGCTTTTGCTTACTATCTTTGCTTGGGGAGAGTTCATTGCTTGTACCAACT
GCAGGTTTCTCGAAGTTTCCTTCATGAACATGAGAGTTATTCTGTGGGACAATATCTTCTGGAGGTATTTCTGATGTATGGATTGGCTTATCTGAAACTC
TTTTTCCTCTCTTTGCTGACTGCTTCTTGTTTTTTCTTTTTTGGACTGCATTTTGCTTACCACCTTTGCTCAGAGGGAGTTCATGGCTTATATCAACTGC
CTGTTTCTCAACATCTTCATCCTGAATATGAGACTGATTATGCGCATCTGGAGGTATTTCCGGTGGATGGATTGGTTCATCTTGCACAAGCATGTCCCCT
CCAAGCACTCCCTGATATCCGATATTGTCATCTTCACCATGCAACACTGACGCATTCCTACCTGGTGCACTACCCAGCACTTTTGTTGTTTCACCTTCCA
AATGATGAGAAGAAGTTTCTGGTTCATTATTTGGCCTCTCGGTAAATGGGTGAATTCACTGGCATGTGCTCTTCCTCTAATGAAACATTTTGCCCGCTAG
ATGCATCCTTTTCTTTGGCAACGTCACTATCTATGCACGCACCAAGTGGAGAACTTACTGGTTCAAGAACATGGTCTGGAAATTTTATGATTGAAGTTGG
GGTCTCCCTTGCAGTAGAGGCCTCACCGTTCGTCAAAACAACATCATTGTAAGAACTGTGCACCTGCGATTGTTTA
page-top