Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24756  (registered. 2003)
Contig Information
Length 837 bp
Clones 39 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 6
Wh_EM Dormant seed with water absorption 6
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 8
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_PCDAM Anther at meiosis 5
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit conserved hypothetical protein [Talaromyces stipitatus ATCC 10500]
Score 91
Evalue 0.301337
Total Hit Count 78
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24756
TTTTTTTTTTGAACAAGGGCAGGGTCCAAAAGGACCCCAAACTTTATTTGATGTTACAATACGGTAGTACAAGCCAGAGCAACAGGACACACAACAAACT
GAAAATTACAACGCAGTCCCTGAAATATGCAGAAAGGACCCCAAAGATCTGAAGAGGAACGCAATCAGGTCCAAGCCACTCCCGATCGACTCCAAACTCG
CCGGCGCCGGGGACATCACCACTTGGTCCGACGAGTTCTTCACCGCAGCAAGCCGTGAACATCGAGCTAGAGTAGCACTGCCTCCCATATAGCTTCAAGG
CTAGGAGGAAGAGGTTTGGCCGCCCTTTGGCCAGAGGATTCGGTGGCGCGGCGGCGCTGCAAGCCGGCTGTCCGCCGGGAGCGCCAAAGCTCAAGCACCA
TCGATGATTTGCTCTGGAACCGGTCGCAAGAGCCGTCTTCATACCAGTCCCCGTCGACTTGACCACCACCATGGTGACTGCCGTCGGCGAGAGCAAGCGA
AGGGGATTCCTGCATACCAGGGAAGACATCGAGCTTATTTCCGAGGATTCCAGCGCACCTCCTTCCAACAGCAGCGAGCCAACCGCCACCACCAACAAGA
GTATCGCCAGGAACCACCGAACGCGGCTCGGGCGCGCCGGCAGCAAAATCCTCATCGGCATGACGCCAATCTCCGGCACTAGGCCAAACTCCTCTAAGGA
AAAACTAGAACTACACCTACTAGCTGCTATAGAGCACCGCGCACCTCCCCCATCACCTCTCCAACCGGCGTCGCCGGCGGCGAAGATCCGGGATCGGGCC
GGGCCCGAGCCGCTTTTGTTTTCGCCTTCTCGGTCTC
page-top