Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24750  (registered. 2003)
Contig Information
Length 784 bp
Clones 39 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 7
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 4
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 3
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit hypothetical protein OsI_06649 [Oryza sativa Indica Group]
Score 784
Evalue 1.18136e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24750
GCCGCACTTCCTCCCTCCTCTCGATTTCGATTGGAATCGGAGCCAGCTCCGCTGCCTGATTAGCCGGCCGGCCCCGGCCCCGTCTCCGTCCCCATGGCGT
CCAAGCGGATCCTCAAGGAGCTCAAGGACCTGCAGAGGGATCCCCCCACCTCCTGCAGCGCCGGCCCTGTGGCAGAAGATATGTTCCACTGGCAAGCAAC
GATCATGGGCCCATCGGAAAGCCCATATGCTGGTGGTGTATTTTTGGTTACTATTCACTTCCCCCCAGACTACCCATTCAAACCACCGAAGGTTGCATTT
AAAACAAAGGTTTTCCACCCAAATATCAACAGCAATGGGAGCATCTGCCTTGATATCTTGAAGGAACAATGGAGCCCTGCATTGACAGTTTCAAAGGTGC
TCCTTTCAATCTGCTCTCTACTAACAGACCCGAACCCCGACGACCCGTTGGTTCCGGAGATTGCACACATGTACAAGAGTGATCGTGCGAAGTATGAGTC
CACAGCGAGGAGCTGGACCCAGAAGTATGCAATGGGCTGACCTTGTGAGCCTAGGTGGAGGATGATGTTGGAGCCATCTTCGCTTGTTACACCTAATGTA
TCTTTGTTCCTGTTCTGCTGCTGCTATATGGGATTGTACTGTCCACCTACCTGACTGAATTCAAGTGTCATATTGTGAAGTGATGGCAGAAGGCCTCTAT
GGGTCTATGGGTGCACCCATCCAACAAATTAATAGAGATGGGAACTGAAACTAAAGTTGTTCCGTTGCTTGACCAAAAAAAAAA
page-top