Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24735  (registered. 2003)
Contig Information
Length 1158 bp
Clones 39 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 35
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 1
Homology (BLAST) Top Hit dimeric alpha-amylase inhibitor [Triticum aestivum]
Score 692
Evalue 1.03253e-70
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24735
TGCATTGCATGCACGTTACATTATTTATTTAACGCTTGACGCTTCCAAGTGGCTACAGCGCCAAAAGCCCCTACCGAACACACAACCGAACTACTACCAG
CTGACACTCGAGACTCGACACGCCGCACTTGCTCGTACATACCACACACCACACCACGGACACACTTCACTCTTGTTCTTCGCGATCTTCTCTATCCCTG
ATCTAGCTATTGACGATGGTGCCACCGTTGGGGTGGAGGATCTGGCCGGAGATGTAGGAGGAGTCCTGCTCGCTGGCCAGGAAGACGAAGCTGGGCGCGA
CCTCGCTGGGCTGCCCGGCGCGCTTCATGGGCACCTCGGACCCGAACTGCTTCACCTTCTCCTCCGGGAAGGAGGCCGGGATGAGCGGCGTCCAGATGGG
CCCCGGCGCGACGCCGTTGACACGGATCCCCTTCTCCGCCAGCTGCATAGACAGCGCGCGGGTGAAGGCCACGATGGCGCCCTTGGTGGCCGTGTAGTCC
AGCAGCGTCGCGTTGCCCTTGTACGCGTTCACGGAGGTGGTGTTGATGATGCTGGACCCGGGCCGCACTCGGTGCTCCTACTATGTATGCTCGTGGCGAC
ACCCATAGCAGCCGAGTACGACGCATGGAGCGGTAACAGTGGTCCTTGGATGTGCTATCCGGGGCAGGCCTTCCAGGTGCCCGCGCTCCCCGCCTGTCGT
CCATTGCTGAGGCTCCAGTGCAATGGCAGCCAGGTGCCCGAGGCTGTCCTAAGGGACTGCTGCCAGCAGCTCGCCCACATCAGCGAGTGGTGCAGGTGCG
GGGCCCTCTACAGCATGTTGGACAGCATGTATAAGGAGCATGGCGCGCAGGAGGGACAGGCAGGGACAGGAGCGTTCCCACGCTGCCGGAGGGAGGTGGT
GAAGCTGACGGCGGCGAGCATCACAGCGGTCTGCAGGCTACCCATCGTCGTTGATGCGTCCGGAGATGGAGCGTATGTCTGCAAGGATGTGGCCGCATAC
CCAGACGCCTAGTCAAGCAAATGAGTAGCTACTATGTTGTGTCATGCACCTGCCTCTTAATTTGTGGGAGTGCGCACAAACTAAATAAAATGGTGTATGT
GCCTATGCGAAATGCATTGGTAATGAATAAAAGTGAAGTTCCCTGTTTAAAAAAAAAA
page-top