Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24730  (registered. 2003)
Contig Information
Length 1446 bp
Clones 38 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 6
Wh_EM Dormant seed with water absorption 4
Wh_EMC Dormant seed with cold treatment after water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit 40S ribosomal protein SA [Zea mays]
Score 1105
Evalue 1.81626e-118
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24730
CGCCTTGCAGTTATGAGCAATATAGCCTCATAAAAAATGTAAGACATATCTACGGTATCACATGATCCGGGCTTTTATAACATTTCAAGAGAATCTGACC
ATACACTTGGCTGGCAAAATGGAACTTCAAATAAAGCTATTCGATGAGAGGCAACAGAAGGCTGGGGCGATAACTCCCAACCCCTGCAAAGCCAAGAAGA
CAAAAATCGATTTCCATCTAACATAACTCAGTACTGTAAAAATTAAATCTACTTAACCAGCGTCTACCAACAAAGTACTGACGGGGCAAATAACACAGCC
TTCACCCATAAACCGCGGCCGAACTCCTTCACTCCACAGTGCCGAGTAGCATAAACCTTGGGTCAAGTCCTTCACTCCCAGTTCGGAGTAGCAGCTGGTG
CTGCTGCGGGTGCGGGAGCGCTGCCCTGTTCCCAGCCAGTAGGGGCAGGTGCTGGAACTGCATCCCATCCATCGGCAGCAGGAGCTGGAGCACCAGTCCA
CTCGGCCCCAGCCGGGGCTTCGGCGGCAGCAGCTGGAGCTGCAGCTCCTGGCCATTCAGCACCCCCAGGTATCCCCCTGCTGGGGCAGTGTACTCTGCAA
CTGCAGCGTACTCAGGAGCACCCAAAGCTTCATCTTCCTCAAGCTCCTTAGCTTCCTCTGGGTCCCTGTAGAAGAACAGATCAACCATGATTTCCCACTT
GTGTCCTGGGAGAATGGTACCACGCATCTGCAGAACCATCCTGGCGAGCAGCCAAAATAGGCAACCAATGCTCTGCTTCCCCTTGTTGTTAGCAGGAATG
CCAATATCAACGTAACGCATAGGAGAGTCAGTGTCGCAGAAGGCAATGGTGGGGATGTTTCCAAGTGCAGACTCCTTGATAGGCTGGTGATCAGTCCTGG
GGTCGGTCAGGATAAGAAGGCGTGGCTCACTGAATGAAGTCTGCATCTGGTTGGTGAATGTACCAGGAGTGTGCCTGCCAGCAATGGCGTTAGCACCAGT
GTACTGGGCAAACTTGAGGACAGCCCTCTGTCCATAGGGCCTAGCAGATTGCACAATGATGTCCTGAGGGTTTTCAATCGCAACAATGACCCGTGCGGCC
ATCTGAAGCTTCTCCCAGGTCTTGCCAAGGTTGATGATGTAAATGCCGTCAGTGCGGCGCTTGTAGACGTAGCGCTCCATCTGGAAGTCGCAGTTCTTGG
TGCCGAGGTGGACGTCGGCGGCGAGCATCATCTGGATGTCCTGCTCGCGCTGGGACAGCGCCCGGACGCCACCGCCTTCAGCCGCCATGGTGGGAGGTTA
GGGTTTCGGACGCGAGCCCCGTGCGCGAGAGAGCGAAGGGGAAGAGGAGGCACGGGTGGTGGCGGCGGGAGAGGTCGCGACGGGTTGGGGACGGGACTAC
TTATACGGGCTGGCCCGTGTGTGGGATAAAACCCTAGCTCGGGCAG
page-top