Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24725  (registered. 2003)
Contig Information
Length 620 bp
Clones 38 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 4
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 4
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit Chain 6, Structure Of Signal Recognition Particle Receptor (Sr) In Complex With Signal Recognition Particle (Srp) And Ribosome Nascent Chain Complex >gi|119390383|pdb|2J37|6 Chain 6, Model Of Mammalian Srp Bound To 80s Rncs
Score 544
Evalue 4.83026e-54
Total Hit Count 456
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24725
TTTTTTTTTTGTTTAGTCAAAACTTCAAGCACTTGAACAAAATATCCAACGTCTCAAATCTTCTATCAAGAAGTCATGGAACATCATGAACAGTAGATAA
CAATAAGCTAAAGCAAGACTTCCCAATATGCTCTCAGCAGATATGTATTAAGTTCTAACTGATCGATACGACAGACAGGGGGTTTAGTCCTCATCCTCCA
CAACCTTGGTACCCAAACCTTTAAGACCTTCCTGGGGAACTTCAGCAACTGTGACCAGAGAGTACAGCTCCTCCTTAGCGTCCTCCTCGTCATTCCTCTT
GCGGGCAATCCTGACACGGACTCTCCTCGGGACACTCCTGATGCCACTGCTCCAGATGTGCTTGTTGAGCTTCACGTCAATGCGGACATCGTTGGTTCCC
ATGGCCTTCTGTGCAAACTTCCTGATCTCCTTGATGGCATTTGGTGCCTTCTTCTTGAAGGTGCATCCATGGAGGCGCTTGTGGAGGTTGACGGTGTACT
CGCGTGTCACCACCTCGTCCTTGCGCGGGCCGGGGGCGCGCTTCTTCTCCGACATCTCCGACGGCCTCCTTTCGCCCTGCTCCTCTCTTGGCTTCGGTGG
AGGCTGCGGCGAGAGGAGAT
page-top