Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24724  (registered. 2003)
Contig Information
Length 1799 bp
Clones 38 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 13
Wh_VHS Shoot with heat shock treatment 5
Wh_VWD Shoot grown with dessication 13
Homology (BLAST) Top Hit Os06g0669400 [Oryza sativa (japonica cultivar-group)] >gi|113596361|dbj|BAF20235.1| Os06g0669400 [Oryza sativa (japonica cultivar-group)]
Score 1682
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24724
GTTCGAAATGCCGAAACCTGACAAAGACCATCCAAGGCTCTTTTTCTTCCCCTCTGCATCAGGAGAAAGCAGAGTTTCCCTGCCAATGGGAAACCAGGAG
CTCTCGCGCAAAAAATCCTTCCCAAGTAATTACATCTTATAATTAACCGCGAGTGAGTTACATTACATGGCCGTGCCTCGAGTAGGAATTAGTGTACATC
CAAGAAATATGAACATCTTACAACAACAACAAATTCTCCAACCCTATAAATGCGGGCGAACCTAGACCGGGACGGCCGCCTGGGGCGTCGGGGGCACCCG
GTTCTCGACGGGGATCTCGGTGAACTCGGACAGGATGGCCCGGAACTCGTCGCCGCTCAGCGTCTCCTTCTCCAGGAGCACCTCCACGATCTTGTCCATG
GCCACGCGGTTGTCCCTCACCTGTTGCAGGGCGATCTGGTAGGCCTGGTCCGACAGCTGCTTCACCGCCGAGTCGATGTCCAGCGCCAGCTTCTCCGACA
TGGAGTTCCGAGCCATCATCCGCATGATCACGTCCCCGCTCTGCGCCGCGTCCATCAGAGACCACGGGCCGATGTCCGACATGCCAAATGTCACCACCAT
CTGCTTGGCTAAGCCAGTGATCTGCTGCAGGTCACCAGCAGCTCCAGTGGTCACCTCAGAATCTCCGAATATGATCTCCTCAGCAGCTCTGCCGCCAAGG
CCGCCGACTATTCTGGCGAAGAGCTGCTGCCTAGAGATGAGCGTTGGGTCATCCATGGGAATGAACCAGGTGAGACCACGGGCTTGACCCCTTGGAACTA
AGGTAACCTTCTGGACGGGGTCGTGGCCAGGCGTCAAAGTTCCGCAAACTGCATGCCCAACTTCGTGGTAAGCAACAAGGCTTTTGCTCTTCCCATCTGT
CATGACAGTTCCTTCCATACCAGCCACTATTCTGTCGATTGAATCATCAATCTCCTTCGAGGAAATTCCGGTCCTCCCACGTCGGCCTGCTAATATGGCT
GCCTCATTCAGAAGATTCGCCAGGTCTGCTCCACTGAACCCAGGTGTTCTCATTGCAATGACCTCAAGGGAAACATCAGCATCGAACTTCTTGTTGCTAC
CGTGCACCTTGAGAATCTCTGTCCTTCCACGTACATCAGGAACATCAACACTCACCTGTCTGTCAAAGCGTCCAGGTCTAAGCAAAGCGGAATCCAAGAT
GTCAGCCCTGTTGGTGGCAGCAACAACAATGATGCCAGTGTTGCCCTCAAAACCATCCATCTCAGTCAGTAGCTGATTGAGAGTCTGCTCCCTTTCATCG
TTCCCACCACCGATACCTGTTCCTCTTTGCCTCCCAACAGCATCAATTTCATCAACGAACACTATGCAAGGAGCATTCTCCTTGGCCTTCTTGAAGAGAT
CACGAACACGGGAGGCACCAACACCAACAAACATCTCCACGATAGCAATGGTCCCGTTCTCAAACAGGTCGACCTTCTTCACCCTGTCCTTGTCGAGGTA
CTCGAGGAACCTCGAGTAGGACATCCTGGAGGAAGACACACCTTGGTCATCGGCGAGAGCCTTGTTGGCAGTCAGCAAGGCGGGCAGGCCGACTCCTCCG
AGCGCAAGCTTCAGGAGCTTCCTCTTGGAATCGTTCGGCTTGTGCTCCAGGGAGGCGGTCACGGACACCGGCCTCTGTGCGACGCCGCTCGAGGGGAGCG
CTCCGAAGGGGAGCAGCCCTTTCGCTGCGAGACTCATGGATGGCGCCATGTTTGCTTACTGAGACGAGCTGGATCGGGGCCGGGGCGGAGGAGGGATGG
page-top