Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24720  (registered. 2003)
Contig Information
Length 883 bp
Clones 38 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 3
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
Homology (BLAST) Top Hit ubiquinol-cytochrome c reductase complex 14 kDa protein [Zea mays]
Score 453
Evalue 3.49498e-43
Total Hit Count 126
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24720
CCCGGCCCAAGAGGGAAACCACAACCACAACCACCCCCCACCTCCCCTCCTCCGCTCGCCAAATCACAAACGCCGAAGAAGAGAGGAGACGAAAGGGGAT
CGCCGCCGCCGCCGCCGCCGAGGATGACGTCGATGCTGTCCGCGTTCTCGTCGTGGTTCGTGAACCCGCGCCGCAACCCGCTGGCCCGCATCCACATGCT
CACCATCTCCAACCGCCTCAAGAACTACGGCCTGAGGTACGACGACCTGTACGACCCCTACTTCGATCTGGACATCAAGGAGGCGCTCGGCAGGCTGCCC
CGGGAGGTGGTCGACGCCCGCCACCAGCGCCTCAAGCGCGCCATGGACCTCTCCATGAAGCACCAGTACCTCCCCGACGACGTCCGGGCACTGCAGACAC
CATTCAAAAGCTATTTGAGCGACATGCTGGCTCTGGTGAAAAAGGAGGCAGCAGAGCGTAAAGCACTGGGAGCCCTTCCCCTCTACGAGAGAACCCTTCC
TTGAAGACATTTTTCCTTGATATGCGCCACAGCTTTTGCTCCTCGTAGCATCACAATGCATGAAATAAAATGCAGATTATGACACTGTTCCTCCTTCCGG
TTTCATGTCCATGGCCTGTAGCTCGTGCCCCTTCCCAAATTAATTGCGACAGAATTTCTGTTGCTGTTGCTGATATAAAAGTTTGTTTTGGTTGACGGAA
TTGTTGCTATAGAAGTCTGAACAAGTCTGTGCTCTTGGGCCTTTTCCGTTGAGCAACTGTTTGTTGTTTGCTTCCGGGTTTACGCTGCCTATTTCTACAG
AGCTGTGGTGCTAGTGATCTGCTATGTGCTGTGAATTGTTCTTCCGAGCTTGCCTAGAGATGTTTCTCTCTCAAAGTTCTACA
page-top