Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24717  (registered. 2003)
Contig Information
Length 612 bp
Clones 38 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 5
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 8
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 6
Wh_RDr Root of dessiccated seed 1
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit plasma membrance protein3 [Puccinellia tenuiflora]
Score 240
Evalue 8.42109e-19
Total Hit Count 258
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24717
TTTTTTTTTTGAAAACTTCCCCACCAATCAATTGATTGATTAATTAATTAATCAAAGTTCAAAGTACATGGACGACGAAAATGCGCGGAGGAACAACACA
AGTGGATGGATGGATACACTACACTGGAGAAGGGAAGGTGACAGGAGAGGAGGCTAATCATCAAGCACGGACAACAACACAGATGTACAACAGCATGAAC
ACACACATGTAGGCAGGCAGCACCATGAACCGTGGCTCGCGTCTCGGACAAACGGCTTGTACCAGACACAGAACAAGTTCGACATGGATCACCTAGAGGC
AGAGGTGAGGAGCCCCTCCTGCAGTCCTACTTGGTGATGACCCAGACGGCGTAGATGATGCCGGGGAGGTAGCCGAAGAAGGTGAGCAGCAAGCAGATCC
AGAACTCGATCCCGCAGGCGAACTTGAAGAAGACGCCGAGCGGCGGCAGGATGATGGCGAGGATGATGTCGATGCAGTTGGCCGTCCCCTCGTCCGCCAT
CTTCCTCGTTCCTTCTCTCTCTCCCTCTCTCTCGAAGCGTCGAAGGGAAAGCCAAGGGAGATGATGTGAACAAGGAGGGCGAGACAGGTAGGTGGAGTAG
AGCGGCACGAGG
page-top