Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24700  (registered. 2003)
Contig Information
Length 629 bp
Clones 37 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 8
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 123
Evalue 3.29845e-05
Total Hit Count 74
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24700
GTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCGC
GGCTCCAGCTTAGGGTTTCTCGCCCCCGCCCTCCCGCCTCACCGCCGGCCCCGTACGCCATGTCGAAGCAAGGAGGGAAGGCCAAGCCGCTCAAGCAGGC
CAAGGTCGCCGAGAAGGACTACGACGAGAATGACCTGGCATACCTCCAGAAGAAGAAGGATGAGCAAAAGGCCCTGAAGGAGCTGAAGGCCAAGGCAGGC
CAGAAGGGTGCGCTGGGAGGATCTGGTCTCAAGAAGAGTGGGAAGAAATGAGTCTGCCCACCCTTACGTAATGCCCAGAAAATGATAATCTATCTATCTA
CCTATCTGTGTCGCGCTTCACTATCTGTGGTTGTAAAAGACTACCTTCAGTTGTGTTGAGCATTAAGCATTGTCGCAGTCGGTTGCTGAAACCTATGGCA
TTTGAGCAGCCTCTTCTGCTTATCTGTGATGCAGATGGTCCCTAGCTAATAATGACATGACTTGTTTTGTGATGAAAATCTCTAATGTGTGCATCAAGTC
TTCCAATTTCTTTGTGTTGAAAAAAAAAA
page-top