Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7812  (registered. 2012)
Contig Information
Length 1020 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XV Leaves, plant was grown at constant 23Ž 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222619809|gb|EEE55941.1|| hypothetical protein OsJ_04636 [Oryza sativa Japonica Group]
Score 348
Evalue 6.00E-94
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7812
GTCTGGGGGTGAGATAATGAGCAGCAGCAGCAGCAGCTTGGCGTCCACCATTTCTGCAGCAGCCACTGCTGCTCGTCCTCGCCATGGCGCGGTGAAGCAG
CAGCTGAGCGCTAGGGTGAAGCCACACCAGAAGCATGCTGCAGGCTGCTGGGAGAGCAGTGGCAGCGGCAGCAGCAGGGCTGTGGTGGCGAGGGCTGGGC
CCGGGCCGCTGACGGAGATTGAGCCGGACCTGCAGGAGGACCCCATCGACAAGTGGCGCACCAACGGCGTCCTCCCGGAGGACTTTGTGTATGGAGTGTA
TGACGGCCACCACACCTATGATGAAGGCCAAGAAAAGAAGGGCTTCTGGGAGGATGTCTCTGAGTGGTACCAAGAAGCTGAGCCTCCTCAGGGCTTCCAA
GCACTCATCTCCTGGGCATTCCCTCCCGCAGTCATCCTCGGAATGGCTTTCGATGTGCCGGGGGAGTACCTTTACATTGGGGCAGCTATCTTCATCGTCG
TGTTCTGCGTCATCGAGATGGACAAGCCGGACAAACCGCACAACTTTGAGCCGGAGATCTACATGATGGAGAGGTCCAAGCGCGACAAGCTCATCGCGGA
CTACAACTCCATGGACATCTGGGACTTCAACGAGAAGTACGGCGAGCTCTGGGACTTCACCGTCAACAGAGATGACCTCATCCAACCATAGGTGCCATTC
AGAAATGGTGGTCGCGTTGGCTAGATTCAGAAATGGAGGCCAGTTCAGATGACATGTATGATAGTGATATAAGCACTCTCTAAGGAAATCAGGGATGGCA
TAGCTCCAAGAAAAGGATCTTCAAATAAAGCATCCTTGTAAAAAATGCAGAGCAAATTGTCAGAAAACACTATGCTACTAAGGATGGCAAATGTCTAAAA
TTGTAGAGATATATAAAGTTGCCTGTTTGGCACTACCCTCTCGATGTTACAAAAGTCTAGCAAAAAAGAATTGTCATTCTTTTTTGTACAAGTTGAAACC
CTATGTCGAATAACGAAGAA
page-top