Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24690  (registered. 2003)
Contig Information
Length 2194 bp
Clones 37 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 3
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 6
Wh_VABA Shoot with ABA treatment 6
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 6
Homology (BLAST) Top Hit Os08g0548200 [Oryza sativa (japonica cultivar-group)] >gi|42407549|dbj|BAD10754.1| putative ER lumen protein-retaining receptor [Oryza sativa Japonica Group] >gi|42408730|dbj|BAD09948.1| putative ER lumen protein-retaining receptor [Oryza sativa Japonica Group] >gi|113624402|dbj|BAF24347.1| Os08g0548200 [Oryza sativa (japonica cultivar-group)] >gi|215686415|dbj|BAG87700.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215734918|dbj|BAG95640.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765587|dbj|BAG87284.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218201565|gb|EEC83992.1| hypothetical protein OsI_30151 [Oryza sativa Indica Group]
Score 1294
Evalue 3.71688e-140
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24690
TAGTATTCTCACAGCCTAAGCTTCACGACCAACAGTCTCCGGTACAATTTTCACCAAACAGTTTATAACTGGAAAAAGAAAAGGCAAACAAGACTCTTGA
ATCCATCCCACATGGGAAGAGAGAAGGTTGGGCGCCAGAAGCAGAGCCACTGTTCAACAGTAAGACACAGCACCGAACAAATGAGTTGTGCACCAGATTT
TACACCACCCCAGAAGGAAGTCGCAGCACTAGTTGTCCGCCAGCAAGACTCTTCACATAGTAGTAGCAGAAATCTGCAAGGATGAACGTCTGGACGATTT
CAGAGAGGAGCACCATCGATGGCCAAAAGCCATAGCCCAGAGCAGTCAATAATCTGCCACGAGTATCCAAGACCTGAAGGACCCAGTGTGCACAGCTAAG
GAACCTTGCCACACCCAACGCAAACACATAATGAGCTGTGAATGGTTCAACAATCTTTGTATTCTGCATCAAGCGCAACTGGGGCAGCACTGAAACAGCT
TCCAAGTAAACACAGAAGGCCCAGCAGATCCTATTGATCATGATATGTGATGTTGAAGGATGAGCAATAAATGCCAGCACACAACATGGTACAACCACGT
AGTACAATGCAAAATTGTCCTTGTCCAGCATATAAGTTGACCTCAGTCTGAACCGAATCATGTAAATGACAAAAAGAGTAGCTACTAGTGTAGCTGAATC
CAGTATTGTATGGATGTCATACTCCATAACAAAGCTGCAATACAACCTAACGGCCAGGAACAATGCTGTCAAATCCTGAGACTTGAGTGAAAGTCCAGCG
CAGGTCTTCTCCTTGGTGAGCTTGTAGATGAGCACGGCGATGCCGAGCGCGTGCGCGGCCTCGGCGGCGACGAAGAGGTTGTCGTGGTCGTGGACGATGA
AGCGGATGAAGACGAGCGCGGTCATGCCCGCGACGACGGCGAGGAAGGCCTTGACCTTGGGCGGCTGCCTCCGCACCCAGCTGAGCACCACCGCCATCGG
CCTCCGCGGCGCCCTCATCTCGGAGCTCCTCCCCGCGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAGCGACGAAATGCTTCGGGGA
GTTGAAAATAAGCATAGATCCGGAGATTCCCAAATAGGTCAACCTTTTAAACTGCCTGCTGAATCCATGAGCAGGCAAGAGACAACCTGGCGAACTGAAA
CATCTTAGTAGCCAGAGGAAAAGAAAGCAAAAGCGATTCCCGTAGTAGCGGCGAGCGAAATGGGAGCAGCCTAAACCGTGAAAACGGGGTTGTGGGAGAG
CAATACAAGCGTTGTGCTGCTAGGCGAAGCGGTTGAGTGCCGCACCCTAGATGGCTAAAGTCCAGTAGCCGAAAGCATCACTAGCTTACGCTCTGACCCG
AGTAGCATGGGGCACGTGGAATCCCGTGTGAATCAGCAAGGACCACCTTGCAAGGCTAAATACTCCTGGGTGACCGATAGCGAAGTAGTACCGTGAGGGA
AAGGTGAAAAGAACCCCCAGTGGGTAGTGAAATAGAACGTGAAACCGTGCTGAGCTCCCAAGCAGTGGGAGGGGAAAGTGATCTCTGACCGCGTGCCTGT
TGAAGAATGAGCAGGTCGACTACCTGATCCGCTCCAAATGGGTGCCTTGCCTCGAGTTCAGCAAGGTTGGGTTCATCTTCCGTGAGCACAACGCATCCCC
TGGGTACTACGATGGCCGGTACTGGACAATGTGGAAGCTGCCTATGTTCGGGTGCACCGACGCCACACAGGTGATCAACGAGGTGGAAGAGGTCAAGAAG
GAGTACCCTGACGCGTACGTCCGCATCATCGGATTCGACAACATGCGCCAGGTGCAGTGCGTCAGCTTCATCGCCTTCAAGCCACCGGGCTGCGAGGAGT
CCGGCAAGGCCTAAACAGCTCACTCACCACGGGCCACATATAAAGTGCCATTGCGGTTTTGTCAACTCTGACATTGCTTTGGGTTTTCCTTCTCCATTTA
TCTTTCTTGTTTGTTCCTAAGAATATGTGTATGTCCATGTTCATGTACCAACATGTCTCGAGAAAGCATGCTCGTATGTGAATGCAATCGGTGGCTATGT
ATATGCACATGCACATAATATATTTATACAATCTGTCGACTATGTATTCGGGTAATTAATAATGAGAAACATCTTTGGCACCGCAAAAAAAAAA
page-top