Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24682  (registered. 2003)
Contig Information
Length 738 bp
Clones 37 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_EMC Dormant seed with cold treatment after water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 7
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 7
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195612550|gb|ACG28105.1| 60S ribosomal protein L33-B [Zea mays] >gi|195655257|gb|ACG47096.1| 60S ribosomal protein L33-B [Zea mays]
Score 542
Evalue 1.21909e-53
Total Hit Count 266
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24682
TGGTTGCGCAGCTCACCCCGAACCCCCAGCTCCCCTCCCCGGCGCCGCCGCAACAGCAAGATGGTGAAGGGACGCACCGGCCAGCGCGTGAGGCTCTACG
TCCGCGGCACCATCCTCGGATACAAGCGGTCCAAGTCGAACCAGTACGAGACGGCGTCACTGGTGCAGATCGAGGGGGTGAACACCAGGGAGGACGTGGC
CTGGTACGGCGGCAAGAGGATGGCCTACGTCTACAAGGCCAAGACCAAGAGCAACGGCACCCACTACCGCTGCATCTGGGGCAAGGTCTCCCGCCCCCAC
GGCAACACCGGCGTCGTCCGCGCCAAGTTCACCTCCAACCTGCCCGCCGAGGCCATGGGGAAAAAGGTCAGGGTCTTCATGTACCCGAGCAGCATCTAAA
AGGTTACTTTGAAGTGTGGAGGATTTCGCTCGCCCCTTAGGTTTCATTTCAGAGTCTTGTAAGATGGATTCAGGCCCGGATAGCAAGTTGAACTGCTGTT
TCACTGTGAAGAACTGTAGTCTTCATGTTATCTCGAATGTGTGGGTCGCACATTATATGATGTTATATGTAGTTCGAACCTGATGCTGTTTTTGCCCACT
TTCTGCGTTCTATCCTTGCAATTTTAGCTATCAAATCTGATTCAGTGATGGTTTTACTCTTCTGATATGAATGTTTGTATGCCCTTTTGATGATTGGTGG
AAGAGTTTAACTTCTTTTGGCTGGGTACTGACCANCGC
page-top