Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24681  (registered. 2003)
Contig Information
Length 1500 bp
Clones 37 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 5
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_VABA Shoot with ABA treatment 6
Wh_VHS Shoot with heat shock treatment 5
Wh_VWD Shoot grown with dessication 11
Homology (BLAST) Top Hit Os08g0502700 [Oryza sativa (japonica cultivar-group)] >gi|42407771|dbj|BAD08917.1| putative aminotransferase [Oryza sativa Japonica Group] >gi|42408130|dbj|BAD09269.1| putative aminotransferase [Oryza sativa Japonica Group] >gi|113624139|dbj|BAF24084.1| Os08g0502700 [Oryza sativa (japonica cultivar-group)] >gi|125562079|gb|EAZ07527.1| hypothetical protein OsI_29783 [Oryza sativa Indica Group] >gi|125603927|gb|EAZ43252.1| hypothetical protein OsJ_026735 [Oryza sativa (japonica cultivar-group)] >gi|215693999|dbj|BAG89198.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215694380|dbj|BAG89373.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1084
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24681
GGCTCCTCCCCTGGTCACCGGCGAGAAAAAGCAAGATGGACTACATGAATGGGCCAGGCCGGAACCACCTGTTCGTCCCTGGGCCGGTGAACATCCCGGA
CCAGGTGATCCGCGCCATGAGCCGGCAGAACGAGGACTACCGCTCGCCGGCGATCCCTGCCCTCACCAAGACCCTGCTGGAGGACGTGAAGAAGATCTTC
AAGACCACCACCGGCACCCCCTTCCTCTTCCCCACCACCGGCACCGGCGCCTGGGAGAGCGCGCTCACCAACACGCTCTCCCCGGGGGACCGGATCGTGT
CCTTCTCGCTGGGGCAGTTCAGCCTGCTGTGGATCGACCAGCAGCAGCGCCTCGGCTTCAGCGTGGACGTGGTGGAGTCCGACTGGGGCTACGGCGCCGA
CCTCGGCGCCCTCGAGTCCAAGCTCCGCACTGACTCGCAGCACACCATCAAGGCCATCTGCATCGTCCACAACGAGACCGCCACCGGCGTCACCAACGAC
CTCCACGCCGTCCGCAAGCTCCTCGATGCGTACCGGCACCCCGGCGCTGCTGCTGGTGGACGGGGTGTCGTCCATCTGCGCGCTGGACTTCCGCATGGAC
GAGTGGGGCGTGGACGTGGCGCTGACGGGGTCGCAGAAGGCGCTGTCGCTGCCGACGGGGCTGGGCATCGTGTGCGCCAGCCCCAAGGCGCTGGAGGCGG
CCAAGACGGCCAAGTCGGTGCGCGTCTTCTTCGACTGGAAGGACTACCTCAAGTTCTACAAGATGGGCACCTACTGGCCCTACACGCCCTCCATCCAGCT
CCTCTACGGCCTCCGCGCCGGCCTCGACCTCCTCTTCGAGGAGGGCCTCGACAACGTCATCAAGAGGCACACACGCCTCGGCACCGCAACAAGGCTGGCG
GTGGCGGCGTGGGGGCTCAAGAACTGCACCGCGAAGGAGGAGAACTTCAGCGACACGGTCACCGCCGTCGTCGTGCCGCCGTACATCGACAGCTCCGAGA
TCGTCAAGCACGCGTGGAAGCGGTACAACCTCAGCCTCGGGCTCGGGCTCAACAAGGTCGCCGGCAAGGTCTTCAGGATCGGCCACCTCGGCCACCTCAA
CGAGCTGCAACTTCTGGGTTGCCTCGGCGGGGTGGAGATGGTGCTCAAGGACATCGGGTACCCGGTGAAGCTCGGCAGCGGCGTGGCGGCCGCCGCGGCG
TACCTCTCGAATTCCACGCCCCTCATCCCCTCCAGGATCTGAGCAAATCCCACGCACGAAAGCAAGGGGGTCGCGAGAAGAAGAACAAACATCATGCAGT
GCCCTGCTTCGGGAGCAGAGCAGGCGTAGTACACTACTGGTTCTGGTTATACTCTCTGTATGTAAAGTTAATTTTCACACACCCATCTGTGCTAAAGGAG
TATAATTTCGTCAACTGAAGCTTTAATTACAGAAAATTGAACCCGGATTAATATTACATGACGTGCCTCTTTTANATGGCTAGGCTTGGTAAAAAAAAAA
page-top