Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24676  (registered. 2003)
Contig Information
Length 4382 bp
Clones 36 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_KMV Shoot grown with continuous light after cold treatment 8
Wh_RDr Root of dessiccated seed 3
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 6
Wh_VHS Shoot with heat shock treatment 3
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein OsI_27183 [Oryza sativa Indica Group]
Score 5344
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24676
AATGTGGCGTTCAGCAAAACCCTATGGAACTTGGCTGCAAGAAAGTACACGTTCAATAAAGCCTGTCAACTTCCAATCCTCTCCTGTCATGGACAATGAA
ACAATTTTGAGACATCAGCAGGCATTTGGTTATTCCAGTGAAGATGTGCAAATGGTAATTGAAACAATGGCTTCACAAGGGAAGGAGCCAACATTTTGCA
TGGGCGATGACATTCCATTAGCCGTGTTGTCACAAAAGCCACACATGCTCTTTGATTATTTCAAGCAGCGATTTGCACAGGTTACAAATCCTGCAATTGA
TCCACTCAGAGAAGGTTTAGTCATGTCTCTTGAAGTTAACATTGGTAAACGAGGCAACATCTTGGAGGTTGGCCCTGAAAATGCTGACCAGGTTACCCTA
TCAAGTCCTGTGCTGAATGAAGGTGAACTAGAATCACTATTGAAGGACCCAAAATTAAAGCCCAAAGTACTCTCGACATACTTCAATATCCGTAAAGGTC
TAGATGGTTCCCTTGAGAATGCAATTAAGGCTCTTTGTGAAGAAGCTGATGCTGCTGTGCGGAGTGGTTCTCAACTTCTTGTGCTTTCCGATCGTTCTGA
AGCACTTGAACCAACACGGCCTGCCGTCCCAATACTTTTAGCTGTTGGTGCCATCCATCAGCATTTGATTCAGAATGGCCTCCGCATGTCAGCTTCAATT
GTTGCTGACACTGCTCAGTGTTTCAGCACCCATCAATTTGCCTGTTTGATAGGATATGGAGCCAGTGCTATATGCCCATATCTGGCATTGGAAACATGCC
GGCAATGGAGGCTGAGCAACAAAACTGTCAATTTGATGAGAAATGGCAAGATGCCCACAGTGACCATCGAGCAGGCTCAAAGAAACTTTATCAAGGCAGT
AAAATCTGGCCTGCTCAAGATACTCTCAAAAATGGGCATATCCTTGCTCTCAAGTTACTGTGGAGCTCAGATCTTTGAAATATATGGTCTTGGCCAAGAA
GTTGTCGACCTTGCGTTCTGTGGGAGTGTATCGAAAATTGGAGGACTCACCCTTAATGAGCTTGGTCGAGAAACACTATCATTCTGGGTGAGGGCTTTCT
CAGAAGATACCGCAAAGAGGCTGGAAAACTTCGGATTCATCCAATCCAGACCTGGAGGTGAATTTCATGCAAACAATCCTGAGATGTCAAAGCTGCTGCA
CAAAGCAATTCGTGAAAAAAGTGATAATGCATACACCATCTACCAACAACATCTTGCAAGCCGTCCTGTCAATGTTCTTCGAGATCTTGTAGAACTAAAG
AGTGAACGGACGCCTATTCCTATTGGCAAAGTTGAGCCTGCAACCTCTATCGTTGAGCGTTTTTGCACAGGTGGAATGTCCTTGGGCGCTATTTCCAGAG
AAACACACGAAGCTATTGCAATTGCAATGAATAGGATAGGTGGGAAATCTAATTCAGGAGAAGGTGGTGAGGACCCAATCCGCTGGAGTCCCCTTACAGA
TGTTGTTGATGGGTATTCTGCGACACTTCCTCATCTAAAAGGTCTTCAGAACGGGGACACCGCCACAAGTGCCATCAAGCAGGTTGCATCTGGACGTTTT
GGTGTTACACCAACATTTTTAGTTAATGCTGAACAAATTGAGATAAAGATTGCACAAGGGGCTAAGCCTGGTGAAGGGGGTCAACTTCCTGGGAAAAAAG
TCAGTGCATACATAGCTCGGTTGAGAAACTCCAAACCTGGTGTTCCTCTCATATCCCCACCACCACACCATGACATCTATTCTATTGAGGATCTAGCGCA
GCTAATTTTTGACCTACATCAGATCAATCCTAAAGCGAAGGTGTCGGTAAAGCTTGTAGCTGAAGCAGGAATTGGAACTGTAGCCTCTGGGGTATCTAAG
GCCAATGCAGACGTAATTCAGATATCAGGTCATGATGGTGGTACTGGAGCTAGCCCAATTAGCTCAATCAAGCATGCTGGGGGTCCTTGGGAACTTGGTC
TTACGGAAACACACCAGACACTCATACAAAATGGATTGAGAGAGAGGGTGGTACTTAGGGTGGATGGCGGATTCAGGAGTGGCCTAGATGTCCTTTTGGC
TGCTGCCATGGGTGCTGATGAATATGGCTTTGGTTCTGTAGCTATGATAGCTACCGGATGTGTCATGGCACGCATTTGCCACACAAACAATTGCCCAGTT
GGAGTTGCTAGTCAGAGAGAAGAGCTACGCGCTAGGTTCCCTGGTGTTCCTGGTGATCTTGTGAATTACTTTCTCTTTGTTGCAGAGGAGGTACGAGCCA
CATTAGCCCAGTTAGGTTATGAGAAACTGGATGACATAATTGGGCGGACAGATTTACTTAAGCCAAAGCATATCTCTTTGGTGAAAACGCAGCACATTGA
TCTTGCATACCTATTAATGAATGCTGGATTACCCAAATGGAGCAGCTCTCAGATAAGGAGCCAGGACGTCCACTCTAATGGCCCTGTTCTTGACGAGACA
ATCCTTGCAGATCCTGAGGTATCCGATGCGATTGAGAACGAGAAAGAGGTTTCAAAGACATATCCAATTTATAATGTTGATAGGGCTGTTTGCGGCCGTG
TAGCGGGTGCCATTGCTAAGAAGTATGGAGATACAGGCTTTGCAGGCCAGCTGAACATTACGTTCACCGGAAGTGCAGGACAGTCCTTTGGTTGTTTTTT
GACACCTGGCATGAATGTTCGCCTAGTAGGAGAGGCCAACGATTATGTGGGAAAGGGTATGGCGGGTGGAGAGCTGGTTGTAGTTCCTGTAGATGATACA
GGATTTGTTCCTGAGGATGCTGCTATAGTTGGGAACACTTGTCTGTATGGAGCTACGGGTGGTCAAGTATTTGTGAGAGGCAAGACAGGAGAAAGATTTG
CAGTTCGGAATTCTCTTGGGCAAGCAGTGGTTGAGGGCACAGGAGATCATTGCTGCGAATACATGACTGGTGGATGCGTAGTTGTACTTGGCAAAGTTGG
AAGAAATGTTGCAGCCGGAATGACTGGTGGCCTGGCCTACATGCTAGATGAAGATGATACACTAGTCCCGAAGGTAAACAAGGAGATTGTCAAGATGCAG
AGAGTGAATGCTCCAGCTGGGCAGATGCAGCTCAAGGGCTTGATTGAGGCCTATGTTGAAAAAACGGGCAGCACGAAAGGTGCCAAAATTCTGAACGAAT
GGGAGGCATATCTGCCACTGTTCTGGCAGTTGGTGCCACCCAGCGAAGAAGACTCGCCTGAAGCTTGTGCTGAGTTTGAGAGAGTACTTGCCAGGCAAAA
AAACAGCAGTACAATCTGCCAAGTGATACTAGCCGAAGCCCAATCGTCAAAATGATCAAAGCTAATCGGAGGTTAAGCGTTCTTACTGCGATACTTGAAA
GTGATTTTCTCAGACCGCGGTCCTTCTAAATCACTAACGTCACCAAAGGCTGCAATTTTGTGGAAGCTCTGTCCAAGGCATCTTCTGGAAACGAGCTTGC
AGATTCCGTCGAAGATTCTTCTGCACGGTCTTGCAGCCTAGGTAACCAACCACCCCTGTAAATTGGTTCGCTGACGCTTGGCTGCAAGGCCCGGCCCCTG
TTGAACTGCTGCTTTCTTGTACAGGATTCCTGGCTTCGCCTGTGTAATTGTATTTTTTGTTCTCGACACATTAGTTCTTATATTTATACCCGTCCTGTGG
TAGGCATGCGAGTTGCATGTGCTTTAGTTCAGTATACAGAAATAAATAAAGTGTATGATGAAGTAGGACTTCTCAGGTGTCGATCCTCGTGCCGAATTCG
GCACGAGGGCGAGCTCCGTCCACAGCTGCTGGACCGGTTCGGGATGCACGCGCAGGTCGGCACGGTCAGGGATGCGGAGCTGAGGGTGAAGATTGTAGAG
GAGAGGGCTCGGTTCGACAAGGACCCGAAAACGTTCCGGCAGTCCTACTTGGAGGAGCAAGGGAAGCTCCAGGATCAGATCACATCGGCTCGGAGCAACC
TCGGTTCTGTGCAGCTCGACCATGATCTCCGGGTTAAGATATCCCAGGTGTGTTCTGAGCTGAATGTGGATGGGCTGAGAGGAGACATTGTCACTAACAG
GGCTGCCAAGGCGTTGGCTGCCTTGAAAGGAAGGGACATTGTGACAGTGGAGGACATTGCCACTGTGATCCCCAACTGTTTGAGGCATCGGCTCCGTAAA
GACCCGCTCGAATCGATCGACTCGGGCTTGCTTGTAGTTGAGAAGTTTTATGAAGTCTTTGGCTAGACTATTCTCGAGGTAAATGTTTTTCTGTCACAAA
GTAAGGCAGGAGGCTTTTTGTTCGGCTGTAAACTTTTATAGCACCTTTCGTAAATCATCTTTTATCGAACTATATCCTGCAT
page-top