Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig781  (registered. 2012)
Contig Information
Length 924 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_f Spike at flowering date 3
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_VABA Shoot with ABA treatment 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 4
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|212274375|ref|NP_001130208.1|| hypothetical protein LOC100191302 [Zea mays]
Score 354
Evalue 7.00E-96
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig781
TTTTTTTTTTGAGAAAAGAAGAGAATCATGAAAATCAACTATTAGCAGCACACAGCATGCAGCTTATGTTTCAATCAATCTCAATACAAGGTTCCTCACT
GAATAAGACTTCATGAGTCAGGCAAATGCTTTTAAATGCTTTACAGCCAACTTATTACTTTCCGAAGCAAGAGCAATTAGGGTTCCGGAGCCAGTAGTAG
GATATATCGACAAGGGCTGAGAGGGCCTTATGCTGAATGGAGCCTCGGGTCCTATATTGTCCTTCTACTCGCCCTGCCTAACAACAAAAAAAGGGAACTC
CAACACCTACAAAAATAGAAGTTGATAACACGGACAGCGCTAGGTCCGATTCTTCAGTCTATCCTCATCTCTACTCCTAGAACATCCTTCACGGCCTCGT
ACGTCACAAACGCGATGGCGATGGAAGGCACCACCTTGACCGAGTTGGGCACAAGACCCTTGTACAGAGCACCAAATCCTTCGTGGCGAACAGTTTTCCT
GAATGCATCAATCATACCATTGTACTGGAGTGCCTCTTTGCCTTCTCCAGTAACAATAGAGGCAGCGTGACTCCAGCCGACCATCTGCATCCTTCTCCTC
ACAACATCAAGAGGGTATGCCACAGTCTGGCCTATGGTTCCAGCCACAGCTCCGCATCCAAGCCTTGTTACTACGTGCAGCTCATTGTCCTTTGCAAGAT
CGAATGCATTTGACCGGAGGAGCCAGTCCTTCAGAGACTCGTACACAGCAAAGTTAAGGCCAACATAAGGGACAACTCCAATCACTGATGGAAGCCAGCC
TCTATATAAAGCACGGAAGCCTTCTTCACGGTACACAGTGCCCAATGCATGAAACATACCACGGTACTGGTNNNGAGACTTCTCTGTCTGAACAGTAATC
CTACCCCTAACCATATCCATGGGA
page-top