Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24655  (registered. 2003)
Contig Information
Length 1331 bp
Clones 36 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 5
Wh_SHC Shoot grown with cold treatment 6
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 14
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit Os01g0847600 [Oryza sativa (japonica cultivar-group)] >gi|15408882|dbj|BAB64273.1| putative aldose reductase [Oryza sativa Japonica Group] >gi|113534329|dbj|BAF06712.1| Os01g0847600 [Oryza sativa (japonica cultivar-group)] >gi|125602659|gb|EAZ41984.1| hypothetical protein OsJ_025467 [Oryza sativa (japonica cultivar-group)] >gi|215769146|dbj|BAH01375.1| unnamed protein product [Oryza sativa Japonica Group]
Score 875
Evalue 1.01933e-141
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24655
TTTTTTTTTTAAACAAACGGCCCCAGCTTTATTATCATGTGTGGAGCAACTTCTTTGGAGGAACACAATTACACCAGCAAACCAACAATCGGTACAGAAC
AGGTGATCCCAGTCGCAGGAACAAGCTAGGATAAGTTCATGCCTCCATTGGCAACACGCGGGTTTAGCAGAAAATCCATACCTAAAGGGGCAAATCCATG
CAGTCTACTGAAGAGTTCCTCCCACAGTGGGGCTAAACCACCATACATCTCTTAAGCTTACAGTTTGACGATACATAACAAGTGACTGACACTAGTAAGG
CGCCCTGCTCCCAGCCACGACAGGAGCCGTCCTAGATTTCGCCGTCCCAGAGCTCATCGTGGGTCTTGTAAACGCTGTCTTTGTTGACGATGAAGTTGCC
CATGAGAAGCCTGGCCTGCTTAATCTCAGAGAACTTTGCAAGCAAGTCTTCTGGAATAGACCAGTCATAAACAGCAAGGTTCTGCTTTATCCGTTCTTCA
CTCACGCTCTTTGGCAGTACACTGTGACCCATCTGAATGTTCCAGCGCAACGCCACTTGTGCAGGAGTTTTGCCAAGCTTCTCTGCAATTGAGAGGACGA
CGGGTTCTTTGAGGACATTACCATTCATCCATGTTGAACCAGGCGAACCTAGTGGTGAGTACGCAGAGAGGTGAACACCGGCCGACTGACAAAAGGTATG
GAGTTTAGATTGCTGCCAACCAGGATGGCACTCCACCTGGTCAACAGCCGGAGGTATGCGAGCTACAGCAAGCAAGTCACCCAATTTCTTCGACGCGAAG
TTACTCACACCAATTGCACGAGCTTTGCCAGCATCATGTAACTTCTCCATTGCTCCCCATGTAGCTGGGATGTCAGGTGGTAAGAAGTTTTCAGGGTTGC
CAATGCTTGTTCCCCTTCCTGACTCTAAATGGCCAATGGATAAGGTAAAGATCCAAGTAGTCAAGCTGCAAGTCATCGAGAGAATCCCCAAGTGCCTCAG
GCACATCTTCTGGGGCATGATGACCACACCATAGCTTAGAGGTGATAAACAGATCCTCACGCTTGACTACACTCTCTTCAAACAGCTTCTTCAGAGCCAA
ACCCACCTCCTTCTCGTTGTTGTAGGCCCTGGCGCAGTCGATGTGCCGGTACCCCGCCTTGACGGCGGCGTAGACGGCCTCGCCGACGATGCCGGGGTCG
GACTGCCAGGTGCCGAGCCCCACGGAGGGGATCTTGGCGCCGGTGTTGAGCACGAAGTGCGTCGCCATCCCCGCTCCCAGACACCACCCGCACACGGAGG
CAGTCACTTGCAGTCTCTCGCAGACGACGCT
page-top