Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24651  (registered. 2003)
Contig Information
Length 1260 bp
Clones 35 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 8
Wh_DPA20 Seed DPA20 6
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_PCDAM Anther at meiosis 4
Wh_SHDr Shoot grown with dessication 1
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit adenine phosphoribosyltransferase [Pyrobaculum aerophilum str. IM2] >gi|18160582|gb|AAL63925.1| phosphoribosyl transferase [Pyrobaculum aerophilum str. IM2]
Score 91
Evalue 0.570149
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24651
AACTTTGCTCATAGTTTATAAAGCTTGACTTTGACCAAAGCTAATACATGGACTAAATAAAAATGAAGGGAGTACGATGGATTGCATGCACACACACCAA
CATATGCAACCTGTACAGATGGATACTGTGAAAACTTTCAATAGCAACCCGCACAACCAAAATTGGTCGCCACTCTATTTGCTTGTATAGCGGACGCTGG
GGAAAATAAAGAAATGAGAGAGCCTTCAATAATGCCAGTGGCTCGCCTGCTCCTCTCACATAGTGTTGCCAATAAGTCGCGGAAAAAGCAGGCACCACAG
TGGCATCACATGATGCTCAATGGAGCGGAACAAGCAGATGCTCAATGTGTTGGTGCCGCCTCCTTGCAGCACCGCTCTTCTTCTACCTCGAGTTGCCTCG
CACAACTCTCCTGCGACTCCACACCAGCCCCCGTTGAGAGTCGAGAGAGTTCCACCGCTCCCGGCCCGATCCCTTATCTTCTCCGACGGCCTCGCCGGCC
GGAGCGGAGACGGGAGAGGTGCATGGCGTTGTCCTATGTATATAGAATCTAGGTATAGGTTGAGGTCGAGTAGTGCCCATGTGGCGTATGGCTGTATGCC
GATGTGGAGAGCGCCGCCGCCGCGTACGAGCAGCGGCTGGTGGCTCACGGTGGCTGCGTCTCAGGCAAGGCTGGCTGGCGGCCAGTCGCTGCCGAGGGGC
GTGCTGCTGGCTCATCCACCAATAAGCTCGTCTGGTCCCCTGTTCTGGAGGCTCTCCGCTACTTCTCTAGCTCGTGGCGTCGCCGTGGTGGTGAAGACGA
AGAGTAGAAGAGATGGAGAACCAGATCGGGTCAGTGCTCTTATCCGGTGGCTGTTTGGGAGTGGCCTTGGCGCCAGCTACGGCGTTCGGCGGCCGGCCGG
CTCCATCACGTCATCGTACATGCTGGCCGAAGGGCGGCCTTTCTACTTCTTCCTCCCGGCCAAGATGCCTAAAGGGAGGCAGCTCATCTTCTGCACGGAG
TCTATGGCGTGGTGCCATGGAAGCTTAGTTGTCCCAAGTGGCAATGTCCCCGGCGACGGCGAAGTTACGGCCGTGCAGAAGATGTCAAGGACCCGATTGC
TTTTCTTATCTGGTTGTTGGGGTCCTCTTTGTAAAAGACAGGGACCAGTGTGTTATTTGCAGTTAGTTCTGGGTCCGTCTGTAAAATGCTGTGTACTTCA
TGTTCAGTGTTAATGCAGCATCAGGGTCCTTCTGGACCCGTCTTTTGTTCAAAAAAAAAA
page-top