Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24645  (registered. 2003)
Contig Information
Length 857 bp
Clones 35 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_KMP Shoot grown under continuous light 4
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 6
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 7
Homology (BLAST) Top Hit cysteine proteinase inhibitor [Triticum aestivum]
Score 635
Evalue 2.62497e-64
Total Hit Count 302
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24645
TGAAATTCTAACGGTCAGATATAATGGGCAGGTTAATGTGAACATGCTAATTGCTGCCCAGGGTAAAACAAGTCAATCAAAAGGCAAAACGGAATAGTAC
AATAATACTGCAGAGAATTTTATTTAGAGACGTGGTTAAAACAACTTGCAAGAAGCGGACTTATTCTTGATATTACACGAGAACACGCTAAACCATGTCC
GATTGATAGCTGCATCAACACCATAGCTGCAGATCCTTGCAAAGCTGGGGCGCGCCTCATGCGATTGCAGCGTCCTCCACCGGCTTGAACTCCTGGAGCT
GCTTAAAGTTCTCCCATGGTTTCTCCCACACCTTAGCTTCATAGAGCTTCTTGGCCCCACCTTCAGTGACCCGAATTGTAATGTAGTGCATCGTGCCAGC
AACAGTTTGCTTCTTCAGCTTCACCACATTCTCGAACTCCAGCAGGGCATTGGCCTTGTTGTTGTGCTCGGAGACGGCGAAGCGGGCGAGCGCGATGACG
TCGAGGTCGTTCTCCTGGCCCATCGGCGAGTCCTTGATGCCTCCCACCAACGGCCCCGCGTCTTCCGCCATGGCAGCCTTGTCCCGTGCGCTCTGCGTCC
GGGTCTGAGTAAACGGCACGACGATGGCGAGTAGCAAGAGCAGGGCGGCCACCGATCCTACGACCCGATATTTCCACATCTCCATCGATCGATCGGGGTC
GGGATTTATAGCTGCAGCGGCAGGGCAGGGGGAGGAGGATACGATCCGTCGGCGATGCAGGCGCGGAGGTGACCGCCGGAGGCGTCTTCTGCGACATCCT
GCGGCCGGCCCTCGCACGATCAGCGGCTGCTCCCTTGTACCTCGAAGTGGTGAAGGC
page-top