Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24622  (registered. 2003)
Contig Information
Length 1843 bp
Clones 34 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 3
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 8
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit UDP-D-glucose epimerase 1 [Hordeum vulgare]
Score 873
Evalue 4.66562e-152
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24622
TACGCCCCACATACTCTCACCAACATTTCTATAAACCACAAGAACAAGAACGGACAATTCTTCAGCTTGGTTATCTAAGCATCCATCACATGGCGTCCTG
GCCACAATTCAAAACAGGGGTGAAAACATAAACATCAAAACTCTACTGCAGAAGTGCTCCAACAAGTTCAAAGTTTCACACGGCACAGAAACAAGGCAGT
GCACATCTAGTCCTCCTCCTCGCCCTCGTTCTCAGCAATGTTGAAGTACCGGAGCTCGTAGACGCTGCGGTCCTTGTTGGATGAAATCACCCGAAGCCAG
TCACGCACGTTGTGCTTCTTCAGGTACTTCTTCGTCAAGTACTTCAAGTACCTCTTGGAGAAGGCCCCGTCGGAGGTGACGGTGACCTTGCTCTTGTCGC
GGGCGACGGTGACGGAGTCCCCGAGGTTGCCGGCCTTGCCCCCGGCGACCTTGATGCGCTCCTGCAGGAACTTCTCAAGCGACGCGATCTCCATGATCTT
GTCGTCGACGGGCTTGGTGCAGTCGATCACGAAGGTGACCGACCCCTTCTTCTTCCCGGCGCCCGCGCCGCCCTTGGTAGCCGCCGCCACGCCGCGCGCC
ATCTCGGTCTCCGCCTTGCCCGCTCTCCGGAGTCTGCTTCGGTGGTGGCTGCCTCGTGCCGAATTCGGCACGAGGAGTTATTCCATGACCGACAAGATAT
CTATATATATATTTCTACAAGGCAAGGGAACCAACCTTATTTCTTCTACTTACTCCATAAGGGAGATGGATATGATTAGCTTTCTAACACGAACAATATA
ATTAATTATAAGCTACTGATGGATCCGACTCACTCACTCACTCCCTATACACATCAGTAGTAGTCTTCCTCTTCTTCTCTCTGCTCTCTGTGGTGGATAA
ATATATAGATGGATGGTGGTGTATATATGCTACTGCTACTGGCTCTGGGGTCTATTAATCAGTGGCCGTTGTCGGTGGATCCGTAGCCGTAGGGGTTCTT
GCTGGCCCAGTTCCACAGGTCTCTGCACATCTCCTCCACCCCATACTTGGCCTTCCACTTGAGCTCCTTCTCAGCTTTGGCGGTGGCAGCGTACACAGTC
TCGGCATCTCCAGCTCTTCTTCCAGCATAAACCAGAGGGATTTTCTTTCCGCAAGCCTTCTCGAATGCAGCAACCATTTCCAGCACGGACGTCCCCTTTC
CAGTGCCCAGATTGTACACCTCGCACCCTATTCTGTCAGAATCTTCGTAGAGCTTCCTCAGGGCGGCGATGTGGCCGTCAGCCAGGTCAACAACATGGAT
GTAGTCACGTACCCCTGTTCCATCCTTGGTGTTGTAGTCGGTCCCATAAACCGTCAGCGCGGGCCGCCTCCCGACAGCGACTTGCTGGACATAGGGCATC
AGGTTGTTGGGGACTCCGAGGGGGTCTTCCCCGATGTAGCCACTCGGGTGCGCGCCGACCGGGTTGAAGTACCTCAGCAGGATGATCTTCCAGTCGGGGG
TCCGAGCGCTGGAGGTCGCGGCAGATGTCTTCAATGACAAGCTTAGTTCGGCCGTAAGGGTTGGTCGCGGAGAGCGGGAACTCCTCGGTGCAGGGCACCT
CCTTGGGCCACCCGTACACAGTGGCTGATGATGAGAACACAAGCTTGTTGCATCCATGTGCTGCCATGACTTGGAGGAGGGTGATGGTGCCGATGAGGTT
GTTGTCGTAGTAAAGCAGGGGCTTCTGCACGCTCTCCCCCACGGCTTTCAGCCCGGCAAAGTGGATCACAGCCTCGAACCTTTGGGTCGAGAAGATTTCG
TCCAGCGCCTCCTTGTCACGAAGGTCCACCTTGCGGAAGTCGC
page-top