Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7805  (registered. 2012)
Contig Information
Length 1352 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_VABA Shoot with ABA treatment 3
Wh_VHS Shoot with heat shock treatment 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125597601|gb|EAZ37381.1|| hypothetical protein OsJ_21719 [Oryza sativa Japonica Group]
Score 383
Evalue 2.00E-104
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7805
GGTGCGACTGACCTATTGTCATTCTTGGCTTTGGAGAGATGGGACAGGTCCTTGCAAAGTTTTTGGCTGCACCATTATCTTTCGGGCTCGAGCGAGATAC
AGAAGGATGGCCGTATGTCGCGTTTGATCTAAATCCTGCTGTTGTAAAGTCAGCCAGAAAATCAGGATTTCCAGTGTTATATGGAGATGGTTCACGCCCC
GCCGTTATGCAATCTGCTGGCATATCTTCTCCTAAAGCTGTCATGATCATGTATACCGGGAAGGAAGAAACAGTCGAGTCTGTCGACAGATTGCGACAAG
CTTTTCCTGCGGTTCCCGTGTATGTTAGGGCTCAAGACATGTCTCATTTGTTGGATCTAAGGAAAGCAGGTGCGACAGATGTTGTTCTGGAAAATGCTGA
GACTAGCTTGCAACTCGGCTCGATGCTTATGAAAGGGCTGGGTGTCATGTCTGATGATGTATCTTTCCTGAGTAAGCTTGTGAGGGACTCGATGGAGTTA
CAAGCTCAGGAGGCACTCAACAACGTCGAGTCTCGTGAAACTACTACCATGGAGTCACTTCAGGTTAGGGTATCGGACTTGGTTGAGTCCAATGGGAACG
GTTCCGGAATGATTCCCCGGGAGCAATCGCTAGGTCTAAGCAGTCGTCCGGAGGTACGGGTGATGAAAACGACTCCGGATAATCCCATGCCTAATTTGAA
CAACAAAAACGAATCTGAAGACGGTGTGAAATATTGTCTCCTGGAAACCGCTGACGGCGAGGAAACGGTGGAGCCTCCAGCGGAAGCAAGGAGATGACGG
ACCAGACCAGTTTCTGTAAAACCAAGGCGCAGTCTGAAGCGAAGGCACTGAACTTGTGGTTTCCTCATAGGTAATAGCTCTCATTGTACAGCACATCTGG
AGACTGAAGCGCCGAAACTTGGAGGCACACAATCTGTGGACACGACGTTTGCACTGCGTCGTGCGAGCTGAGATTTGCAGCTCGCAAATTGAAACCGGAA
ATGTCAATTCGGGCATATTGAGATTTACAGCCGTGATTGGAATTTGCGGCGGGCATTTAGAAATTGAAGCATCAACATTTCAGAATCCCTGAAAAGCATT
ATTGGCAGGGTGATTTGTGCAAGCAGAAGTAACCTGTATGGCTAGATAATTATTTGTATCACATTTCTCTGATTTGTGTCTGTTGTATACAACTAGGACC
GTAGGCCAAATAATTCCTGTAAAAAAAATCATGTACATGCGCACATGCAGAAACTAGTGAGTGTATAATAATACTGGACCAAACGGTTTGTCCTCGCCGC
GACAAGTTGAACTTTCTGAATGAACCTGAAGCATTGCCTGCTAAAAAAAAAA
page-top