Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24618  (registered. 2003)
Contig Information
Length 1703 bp
Clones 34 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 4
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit unknown [Zea mays]
Score 94
Evalue 0.382347
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24618
CGAGGCCTCGTGCCGGCCGCGTTCTCCTCTGTGGCACGCAACCTTTGTCCCCTCTAGATATAGAACAACACGCCTCGTCCACCCATACCTCTAGAAGTCT
AGATCTAGGCCTGACCCGTAGTTTTCTGATCGTGTTCGCTTCGATCTCGGGGTAAGCTGAGTTCGGCGTCCATGATTTGTTCCTATCACCCGTTTGTTAT
CTGATTCTCAGGTTTCTCCTTCTGATCGGCGAGTTGGGGCTTGCGGCGATCTTGGAGCATAGACGGGAGGCAAGCTGGATCTGCGCACGGAAGCTTCCGA
TCTGACCGGCTGGCGTCTCAGATCTGCTGCTGGTCTGATGCTAAACGGCGGATCTAGATGTTCCCGGCGGTCTCGGTATGTTGCAGCGGCGGGCCCGGAG
GGGCTCTCTCCGGCGAGTACGTGGGATCCCGTCTGCTCCTCCACCTCGTGCGACGACGGCCGACGGCTCTTTGTGTTGATAATTATTCGATGCTATGTCG
ATAATTATTAGATCTAAGAGATCGGAGGTGACGTAAGGTAAGAAGATGTAGCAAGCGAGGTGCTTGTGGAGAGGTCGGAGGAGAGTGAAAAAAAAGAGAT
GTGAACATCTAGAGGCCTTTGCCATGTTGGGTGCGCTCGCATGGCAGGCCGCCACCATAATAAAGATGTTTTTTTGTCTCGGGGGGAGATCGCACGGGGG
TTATCTTGTTTTAGCCCCGGGTTCTCCCCCCTGTGTGCTGGTGTGCTCCTTTGTCCGCACCCCTCGTCCGATCCGACTACATGGCACAACGTTCTACCGT
CGCAAATCGTTCATGGAGCTACCCTCGAAAGACCAAAGGTACAATTGATAATTTACATACCGCTGAACCGTACATAAGCTTTGACAAAGTACCTATTTCA
TTCAAAAATTATCTTGAATTCATTCAGAAGTTACTTGCATTAATATAGAGAAATTGTACAACATCATCACAAATCTGTACTCGACAACTACATGCAGTCC
AGCATAATCAAATCTTGCACATATGTTCTTCACTCAAAATTGTGTTTATTTGTATGATATTCTGAACTAAATTTAAGTATTTCTCTGTATGGAAGGATCA
TATTATCCTGTAAGAACATTTTAGACCCTATTTCTTGTGGTCAGCTGCTTCATAATGTAAGATGTCTTATGTTAGAAATAATTTATGTAGCTTGAACAGC
TGTAAGTGGTCCGTGTATTACCCAAATGAAGCTTACAGTACAATTATCGCTGCACCGTCGAATGGATGTTTCTCTCGTTGGAGCTTCGATGGCTGAAGAG
ACGTGAAGAGCTATTTGATTCTGGACAAATCTGTGACCGTGAATTTCCACCGGCAGGATCGTCAGAAGTACCTACTAATCTGGAAAATCATTTATTAAGT
CAGATGTACCTACTAATCTGGAAAATCATTTATTAAGTCAGATGTACCTACTAATCTGGAAAATCATTCATTAAGTCGCAATTTGAACAGTTATGCTACT
GTTGTAGCTTAAACATTACATCGATTTGGTTCATTGGTTTGTACATAATTTTTTATTTTTTATTTTGTGGACCTTGTTTCACAAATTATGGCACAGCTGT
TGGTTTTATTTATTAGATGATAGTTGATTTGGACAGTTTAGCGTATGGCAACTATTAAATTGTTTCATTCTATTTTGGAGTACTTATTGTTTTAGACTCG
TCC
page-top