Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24612  (registered. 2003)
Contig Information
Length 2290 bp
Clones 34 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 4
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 4
Wh_VHS Shoot with heat shock treatment 12
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit HSP70 [Triticum aestivum]
Score 2136
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24612
TTTTTTTTTTAAACTTAAAAAACGAGAAGCTCTAAGCATCAAGGGTTCCAAACCAACAAGCAAACATCATCATCCATCATGTCTTTCAGATCAAACGACT
CCAACGAACCACTACTACTACTTGCAGCTAGATGACACGACGACAGACGACTGGCACCACCGAGCGGCATCCAGAGGACACCGAGACAGAACACCCATCA
AGTAGCGCGCAGACATTGGACGAACAGCTTAGTCCACCTCCTCGATCTTGGGGCCGGCGCCGCCAGCACCGGCGGGCATGTCCTCGTCCATGCCCATGCC
GCCGCCCATGTCCGGCGCGGCGCCCTGGTACATCTTGGCGATGATGGGGTTGCAGATGCCCTCCAGCTCCTTCATCTTGTCCTCGAACTCGTCGGCCTCG
GCGAGCTGGTTGGCGTCCAGCCAGCTGATGGTGCCCTCGATCGCCTCCTCAACCTTCTTCTTGTCGTCGGCGCCGAGCTTGGAGGCGATCTTGTCGTCCT
TGACCGTGTTGCGCATGTTGTAGGCGTAGTTCTCCAGCGCGTTCTTGGCGTCCACCTTCTTCTTGTGCTCCTCGTCCTCCGCCTTGTACCGCTCCGCCTC
CTGCACCATCTTCTCGATCTCCTCCTTGCTCAGCCGCCCCTTGTCGTTGGTGATGGTGATCTTGTTCTTCTGCCCAGTCGTCTTGTCCTCCGCCGACACG
TTCAGGATGCCGTTGGCGTCGATGTCGAAGCACACCGTGATCTGGGGCACGCCGCGGGGCGCCGGCGGGATGCCAGAGAGCTCGAACTTGCCCAGGAGGT
TGTTGTCCTTGGTCCTGGCGCGCTCGCCCTCGTACACCTGGATCAGGACGCCCGGCTGGTTGTCCGAGTAGGTGGAGAAGACCTGCTCCTTCTTGGTGGG
GATGGTGGTGTTCCTCGGGATGAGCGTCGTCATGACGCCGCCGGCGGTCTCCAGGCCCAGGGACAGCGGCGTCACGTCGAGCAGCAGCAGGTCCTGCACC
TTCTCGTTGCCCTCGCCGCTCAGGATGGCAGCCTGGACGGAGGCGCCATACGCCACTGCCTCGTCGGGGTTGATGCTCTTGCACAGCTCCTTGCCGTTGA
AGAAGTCCTGGAGCAACTGCTGCACCTTGGGGATACGGGTGGAGCCACCGACCAGCACCACGTCGTGCACCGTGCTCTTGTCCATCTTGGCGTCACGGAG
GCACTTCTCCACCGGCTCCATGCACTTGCGGAAGAGGTCCATGTTGAGCTCCTCGAAGCGAGCCCTGGTGATGGTGGTGTAGAAGTCCACACCCTCGTAC
AGCGAGTCAATCTCAATGGTGGTCTGTGCAGTCGACGACAGCGTGCGCTTGGCACGCTCGCACGCCGTACGGAGACGACGCAGAGCACGCGGGTTGCCGG
TGATGTCCTTCTTGTGCTTGCGCTTGAACTCCTGGACGAAGTGGTTCACCATGCGGTTGTCGAAGTCCTCCCCTCCCAGGTGAGTGTCACCAGCGGTGGC
CTTGACCTCGAAGATGCCCTCCTCGATGGTCAGGAGAGACACATCGAAGGTGCCACCACCAAGGTCGAAGATGAGGACGTTCTTCTCGCCGGTGCTGGTC
GCCTTCTTGTCAAGGCCCATAGGCAATGGCAGCAGCAGTGGGCTCGTTGATTATGCGCAGCACGTTCAGCCCAGCGATGGCACCAGCGTCCTTGGTGGCC
TGGCGCTGGGAGTCGTTGAAGTAGGCCGGGACGGTGACCACGGCGTTCTTGATGGAGTTGCCGAGGAAGGCCTCAGCGATCTCCCTCATCTTGATGAGCA
CCATGGAGGAGATCTCCTCCGCAGCAAACTGCTTCTCCTCGCCCTTGTAGTTGACGACGATCATAGGCTTGTCAGCCGGGCCAGGGATGACCTTGAAGGG
CCACAGCTTCATGTCACTCTGTACGGAGGGGTCAGAGAACCTCCTGCCAATCAGCCGCTTCGCATCGAAGACGGTGTTGGTGGGGTTCATGGCGACCTGG
TTCTTAGCGGCGTCGCCGATGAGGCGCTCGGTGTCGGTGAAGGCGACGTAGGAGGGCGTGGTGCGGTTGCCCTGGTCGTTGGCGATGATCTCGACGCGGT
CATGCTGCCACACGCCGACGCAGGAGTAGGTCGTCCCGAGGTCGATGCCGATCGCCGGCCCCTCGCCCTTGGCCATCTCCGCCTCCTCTCCTCTCCTGGG
AATCGCTCGCTCGCTTTGGGGTTCGCCGGAATATTGGGACGGCGGCGCTCTCTGTGTGATTTGCCTGGTGCGATTTGCTTTGCCTCTCTC
page-top