Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24605  (registered. 2003)
Contig Information
Length 800 bp
Clones 34 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 7
Wh_DPA20 Seed DPA20 4
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 5
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit ribosomal protein l34 [Triticum aestivum]
Score 491
Evalue 1.15928e-47
Total Hit Count 304
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24605
TTTTTTTTTTGGGCGCAGCAAACTGTTNTNGTGTGACAAATAAAGCCTGACAGCGTTAACTGAGCTAAGCAGCTCAAGAGCATCTAAGCCGAATTGGAGC
CCGAAAGCTCTTGCATCAAAGGCTAAGCATCCATAGAGAACCAGGCGCAAAATCTAGAGAAGCACATCAAACCTCACATACTAGAACCAGGATTCTGCAA
ATCCCAAGAGAGAAAATTCTTGATTGCTTAAAACAAATTCGGAGAAACACAAAACATCACCGCGACGCCTATCTCGCCCAGTTGTTTAGCTCTTGGTGGT
CTTCTCCTTGGTCTTCTGGATCTTAAGCACCTTCTTCACAATCTTCTGCTCCTCCACCAAAAACGCCCTAATGATCCTCTCCCTGACTGCAGGACCAGAC
AGAACACCACCATAAGGACGGTTCACAGTCCTCCTGTTCCTCGACAATCTGGACCTCTTGTACTCAGTAGGCCTCAGGTGTGGGATTCCTTGGATCTTCT
TGCCGGTAACCGGGCATTTTGGCCCACTCGCCCGCTTCTTGGTGTACTGGTAGACAAGCTTCCCACCTGGGGTCTTGACGACGCGAGTCTGATTCGACTT
GGTGGCGTAGCTGTGGCGCTTTCGGTATGTCAGCCGCTGCACCATCTCGCCGCCCTCTCCCGGAGTTCTCTCGCCGCTTGCTCTTTCGCTCCCGCTGTCT
GTAACGAGGCGGCGCCGAAGGGAAGTGAGGGCTGGGGAGAAAGAAGAGCTTTTATAGGGCTGTAGGTGGTCCGGGTGACCTAGATCCAACGGTGGAGGAC
page-top