Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24595  (registered. 2003)
Contig Information
Length 1134 bp
Clones 33 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 4
Wh_SHC Shoot grown with cold treatment 7
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 4
Homology (BLAST) Top Hit RecName: Full=Mitochondrial outer membrane porin; AltName: Full=Voltage-dependent anion-selective channel protein; Short=VDAC >gi|456672|emb|CAA54788.1| voltage dependent anion channel (VDAC) [Triticum aestivum]
Score 1347
Evalue 1.11704e-146
Total Hit Count 429
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24595
TTTTTTTTTTGAATGAATGCTGAATCAAGTTCAGAATTTTCAGAGCTTGAATTATTACTGAGAAGTGTGGCTCAACGGACAGGCACTACACCGAGCAAAG
ACAAAATTCCTCAGGAATGAAACACGGCAGTTCTTCAAATCTAACAGACTGCAACAACGCGCCCAAGGCGTGTGAAGTATTGTCAACCCGCCCCGATTTC
ATCCGAAACCGAGGAACACCCCTGAGAGCTTAGAGAAGAGGGGCTTGACTTCGCCATTAAGGCTTGAGAGCAATCGCGATTCCGACCTTCGAGCTCTTCT
CGATGGCCTTGGTGTCCACCTCCGCCGAGATGGTGCACAGCGACTTTGGCCTGAACTCGTGCTGGATCAGCGCGCTGGCCTTGCCAGAGTTGTTGATGCG
GGCCTTCACAAGGGTGAGCGGGTCCAGGGTATGCTGGGTGCCGAAGGTGAGGCTGTTCTCGTTGCTCGAGAAGCTGTGGGTCAGCTCTGCCCCGACAGCT
GTGCCGGATTTCTCCACAATGTGGTAATAGGATGCGGTCAGGCTGTCTCCCTTGTTGTTCAGGTTCAGGGATGCAATAAGATCCTGGTTAGTGTAGCTAA
GTGCAGCATTGTATTTGGTGAAATTCTTGGTGGCTGTATCAAGCGACACGTCAGCACCAACAGCTAGAGCACTAGTTCCGAACGCGCCGGAGAGGTTGAC
TACAGGATTGGCAGTCAAGCCAATGCTTGCATTAATACCAGCATAATCATGCAAGTACTGGAGCTCAACCTTTCCAGATTTCTGATCAGGAACAGCAAAG
CTCAAGATGGTCTTCAGCCCTGGTGCTGCAAGATCGTCAGCAGTAATTGTAGTAATGACATTCGATGCTGAGTTGGCCTTCACATCTACAGTGATGTTTT
TGTTCTTGATCTGTGATTGGATCTCACCGAGTATAAGATCAGCCTTCTTTGTACTGGTAGCAGTAATTGCGGCGCCATTGGCGGTGTAGGTGGTAAGGGT
GAATTTGTGGTCGGTCTGGTAGTCCCTGTACAGCAGATCCTTGGCCTTCTTGCCGATCCCGGAGTAGAGGCCTGGGCCGCCCATCTCCGCCGGTGAGCTG
GGATGCGCCTGCGCCGCTGGAGCTGCGTGGGTTT
page-top