Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24587  (registered. 2003)
Contig Information
Length 1054 bp
Clones 33 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 6
Wh_OKCS Seed DPA5 7
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Homology (BLAST) Top Hit putative cytochrome c oxidase subunit [Triticum aestivum]
Score 555
Evalue 6.91889e-55
Total Hit Count 227
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24587
CCCCTCCGGTCTTTTCTCTCCTTCCCTCTAGCTCGCAGCCGCCGCGCGTGACTCCAGATCTCCCGCGGCGCGACCATGGCGGCGGAAGGCAAGGTCCCGA
CGCTGGCCGAGGAATATTCACTCCCACCCAAGGAGGTCTCTGTGGAAAAATCTGCTACGAGCACTGTGGCCGAAGTTGTTCCTCAGAAGGATACTGAAAC
CTCACCAGCTGATGAGACCGCTGCTGCTGTTGAGGAAAAAAGTGAAACTCCTGAGGTGAAAGAGCCAGAAGCGGAAGAAACCGTTCCTGCTGCAGAGGAA
AGCGATGAGGCTCCTGAGGAAACTGAAGAGAAACCAGAAATTGTGATTGAGACTGCTCCAGCAGATTTTCGTTTCCCCACAACAAATCAAACAAGACATT
GCTTCACGCGCTATGTTGAATACCATAGGTGCGTAGCTGCAAAAGGAGATGATGCTCCTGAGTGTGAAAAGTTTGCAAAGTACTATCGATCACTATGCCC
AAGTGAATGGGTTGAACGTTGGAACGAGCAACGGGAGAATGGCACATTCCCTGGACCCCTGTAAGCTTCAGTGGCGCTGGAAGGACAAACATACCATCAT
CCCCACCTATTCTCCCTGGTGACTGGACAAAGTTACTTTCTGCCGAGAATTCGTCACCTTCCTTTCCTTTTTGAGGACTACTTACAAATAAGTTTTTGAC
TTGATGTAAGCTGAAGGTGTTGCCCATCAGTTTCTCCCAACGATCATTCACTGGATTTTATACAACATCCACCTTTGGAATTTGACTGAACTTGCTGTTT
TGCGCGGCACGGTTCAAGACGGTCATTTTGGTTGCACAGGAAATTTCGAAACCGCGTGGAATAAAATTAGCAACCTAGTTCTAGCAGTGCCAATGTTTCA
GAAACCCATTTCATTTCTACCGTCTTCTAAGCAGTACATTTTATTTGGTTATATAGCTTATAGGGCATATAATCTGCATAAAGGAGGCAATGACCTGCTT
CTTAATTCACAAGGCATTGTGCGAACCTGAAATTTGGTGTGGTTACTATGATCA
page-top