Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24557  (registered. 2003)
Contig Information
Length 1096 bp
Clones 32 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 6
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_PCDAM Anther at meiosis 4
Wh_SHC Shoot grown with cold treatment 5
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit Os05g0489600 [Oryza sativa (japonica cultivar-group)] >gi|1703380|sp|P51823|ARF2_ORYSJ RecName: Full=ADP-ribosylation factor 2 >gi|1132483|dbj|BAA04607.1| ADP-ribosylation factor [Oryza sativa Japonica Group] >gi|13646976|dbj|BAB41081.1| ADP-ribosylation factor [Triticum aestivum] >gi|23304413|emb|CAD48129.2| ADP-ribosylation factor 1-like protein [Hordeum vulgare subsp. vulgare] >gi|50511366|gb|AAT77289.1| ADP-ribosylation factor [Oryza sativa (japonica cultivar-group)] >gi|113579443|dbj|BAF17806.1| Os05g0489600 [Oryza sativa (japonica cultivar-group)] >gi|125552797|gb|EAY98506.1| hypothetical protein OsI_20417 [Oryza sativa Indica Group] >gi|125594700|gb|EAZ34759.1| hypothetical protein OsJ_018242 [Oryza sativa (japonica cultivar-group)] >gi|215692842|dbj|BAG88186.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215695044|dbj|BAG90235.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767619|dbj|BAG99847.1| unnamed protein product [Oryza sativa Japonica Group]
Score 939
Evalue 2.18821e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24557
ATTCGGCACGAGGCGACAGCCATCTCTTCCGTGCGGTTCCAAGCTCCAACTCCCACGCCCGTCTCCCCCGAGATCAGGAGGAGCACGCCGCACCGGAGCG
CCGAGACCTCGAAGCCTTCGTCTCCACCTCGGAGCAGAGATGGGGCTCACGTTCACCAAGCTGTTCAGCCGCCTCTTTGCCAAGAAGGAGATGAGGATTC
TCATGGTTGGTCTTGATGCCGCTGGTAAGACCACCATCCTCTACAAGCTCAAGCTCGGAGAGATCGTCACCACCATCCCAACCATCGGATTTAACGTCGA
AACTGTTGAATACAAGAACATCAGCTTCACTGTTTGGGATGTGGGGGGCCAAGACAAGATCAGGCCCCTGTGGAGGCACTACTTCCAGAATACGCAGGGC
CTCATTTTTGTTGTCGACAGCAATGATAGGGAACGTGTTGTTGAGGCTAGGGATGAGCTCCACAGGATGCTGAATGAGGATGAGCTGCGTGATGCTGTGT
TGCTTGTATTTGCAAACAAACAAGATCTTCCTAATGCCATGAATGCTGCTGAAATCACCGACAAGCTTGGTCTGCACTCCCTGCGCCAGCGGCACTGGTA
CATTCAGAGCACTTGTGCAACGTCTGGCGAAGGGTTGTACGAGGGACTTGACTGGCTCTCCAACAACATTGCCAACAAGGCTTGAAGCGTCTCGACAAGT
GCTTCATCAAGAAACAAACGTGCTGGATGTCTCAACAACTCACTGCTACCATTTTACATATTGTGATATATATACACTGCACAAGAGATAGTATGTGTGC
GTATGTGACAGGCAGAAGCTCCCTTCTTTAAGTGAGCTAGTATCAGGTCAGGTTGTCTTTTTTTGTATGGATATTATCAGCTGCTGTTCGGTGGTTTTAC
AAGGTTTAATGTGTCGACAATGTGTGTCTGAACCCCTATCTTTTTGAGTTTTAGTAAGATTGGATTATGGTTGCCAATGTTGGTTGGTTCAGTTGAGTGA
TGTGGATGGTACATGTTGCGAACATACTTATGTGAGCGATGTTTTCAGTAGTTCTGTATACGATCCAGTCGGTGCTGGTTCTGCTCAAAAAAAAAA
page-top