Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24541  (registered. 2003)
Contig Information
Length 1099 bp
Clones 32 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 32
Homology (BLAST) Top Hit alpha gliadin [Thinopyrum ponticum x Triticum aestivum]
Score 479
Evalue 4.78781e-46
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24541
GTAGAGCGCATCATTTAAGCCAAGCAAGCAGTGCTCAATACAAATCCACCATGAAGACCTTTCTCATCCTTGCCCTCCTTGCTATTGTGGCGACCACCGC
CACAACTGCAGTTAGAGTTCCAGTGCCACAATTGCAGCTACAAAATCCATCTCAGCAACAGCCACAAGAGCAAGTTCCATTGGTACAAGAACAACAATTT
CCAGGGCAGCAACAACCATTTCCACCACAACAGCCATATCCGCAGCCGCAACCATTTCCATCACAACAACCATATCTGCAGCTGCAACCATTTCCACAGC
CGCAACTACCATATCCGCAGCCGCAACCATTTCGACCACAACAACCATATCCACAGCCGCAACCACAGTATTCGCAACCACAACAACCAATTTCGCAGCA
GCAGCAGCAGCAGCAGCAACAACAACAACAACAACAACAAATCCTACAACAAATTTTGCAACAACAACTGATTCCATGCAGGGATGTTGTATTGCAACAA
CACAACATAGCGCATGGAAGCTCACAAGTTTTGCAAGAAAGTACTTACCAGCTGGTGCAACAATTGTGTTGTCAGCAGCTGTGGCAGATCCCCGAGCAGT
CGCGGTGCCAAGCCATCCACAATGTTGTTCATGCTATTATTCTGCATCAACAACACCACCACCACCAACAACAACAACAACAACAACAACAACAACCGTT
GAGCCAAGTCTCCTTCCAACAGCCTCAGCAACAATATCCATCAGGCCAGGGCTTCTTCCAACCATCTCAGCAAAACCCACAGGCCCAGGGCTCTTTCCAG
CCTCAACAACTGCCCCAGTTTGAGGCAATAAGGAACCTAGCGCTACAGACGCTACCTGCAATGTGCAATGTGTATATCCCTCCATATTGCACCATTGCTC
CATTTGGCATCTTCGGTACTAACTGAGAAGAGAAGAACTCTAGTAGTAGATATATGATACACCGTTTTCTTAGTCCATGGTTTGGTCGTTGTAGCGGTGA
AAAAATAAAGTGACATGCACTATCATGTAAGAACCTGAACTATACTAGTTCAAACTTGGGAATAAAAGACAAACACAGGTCTTGTCTACAAAAAAAAAA
page-top