Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7796  (registered. 2012)
Contig Information
Length 982 bp
Clones alternative view 34 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 1
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 3
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 1
Wh_VHS Shoot with heat shock treatment 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 1
WH_XA Root 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 9
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|118152396|gb|ABK63942.1|| ribosomal protein L3-A3 [Triticum aestivum]
Score 517
Evalue 9.00E-145
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7796
ATTGTCCACTTAGAGGCTACAGCAGCTGAAACATTAGCTTCCAAATTTGAAGGCATGCAAATAGCATTACTATAAAGTTCAAAATGCATAAACCTCATCA
GTTCGAACATTCGCAGCAGCTCAGAGTTGCAATTGCAATGCATAAACCGATACCCAAACAATCTGCCACAAAGCAAGAAAAAAAGCTGGTAACACTATGG
GATAAGATCTGTCGCAGCCTAAGCCTTGAGCCTGCCGTAGAACTTCTGCTTCTCGTCAGTGGTCTGGAACCGGCCATGCCCGAACTTGGATGAGGTGTCA
ATGAACTTGAGCTTGATCTCCTCAAGGGCCAACCGCGATGTCTGCTTCAACAGGGACTGGCGGAGGGTCACCACTCTCTTCTTGGGGCCCACACAGCAGC
CCTTGATCATGAGGTAGTCACCCTTCACCACACCATAGTGAGGGAAGCCACCCATCGGGGTGATGTCCTTCTCAGTCCTGTCAAACTCAGTGCAGGCCTC
GTGAGACTCCTGTCCAGACTTGCCCATCTTGTAAATCTTTTTGTTCATCTCTGTGCGGTGGTGGTAACCATTCTGACCAGCACGAGCAACAGTGTAGGAA
ACCCTAGCAGGATGCCAGGCACCGATACAGGCAACCTTTCGGAGACCCCTGTGGGTCTTGCGGGGAAGGCGGGTCACACCCCAGCGAGTGACGACACCTT
CGTACCCCTTACCCTTGGTGACACCAATGATGTCAACCATTTCATCTTTCTGGAAGACCGCTTCAACTGGGACTTCCTTCTCAAAGAACTTGTAGCCATA
GTCAACCTTGTCTGCGATGGTGCCACCATTAATCTGGATCTCCATGAGGTGAGCCTTCTTCTGTTTCAAGCCTTTCATCTTCCTAATCTGAGTATGGGCA
ATAACACGGACAATAGTGGCATACTTCTTCATTTTCTCAAGCTGCAACTNGATTTCCTTCTTGCCCGCATCACAGTCATACT
page-top