Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24526  (registered. 2003)
Contig Information
Length 669 bp
Clones 31 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 5
Wh_RDr Root of dessiccated seed 3
Wh_VABA Shoot with ABA treatment 3
Wh_VSCB Liquid cultured tissue 4
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit ubiquitin-like protein 5 [Hordeum vulgare]
Score 385
Evalue 1.57162e-35
Total Hit Count 149
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24526
TGACCACCACCACCCCCAATTCTCAATCGAAAAGCACAAGGCCGCTGCAGCTCTCGCCGGGGCTAGGGTTTCGTCGATCGATCGATCAGTCGACGCGAGC
GGGAGCGAAGATGATCGAGGTGGTGCTCAACGACCGCCTGGGGAAGAAGGTGCGCGTCAAGTGCAACGAGGACGACACCATCGGCGACCTCAAGAAGCTC
GTGGCGGCGCAGACCGGGACCAGGGCCGAGAAGATCCGCATCCAGAAGTGGTACACCATCTACAAGGACCACATCACCCTCGGCGACTACGAGATCCACG
ACGGCATGGGCCTCGAGCTCTACTACAACTAGCCTCATCACCCCCGCCATTGCAGGTTCGTCACCTATCGTTGCCTGTGATGAGCGTTGGTTGCATTCCA
GTCCCAGTGTCTTCAGAGCTCGATGTGTGGGCTGAACTCCAGCGAGCTACTATATAAGTAGTGCATTATTGTACCCATGATGATTATTGACAGCCTGAAC
ATACTTTTCCTGTGATCGACCTGCGAATCTAATGTGCTGTTACTGTGAAGTTTATAAATAACATAAACTGTGTTACCCTGGGGTTGTGATGATGGCAGTA
TTACACTGTCACATCATGTTGTTATGTTATAAGGCATTTGCTCTGCTTAATTTTCACTCAAAAAAAAAA
page-top