Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24508  (registered. 2003)
Contig Information
Length 1138 bp
Clones 31 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 6
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit 14-3-3 protein homologue [Hordeum vulgare subsp. vulgare]
Score 780
Evalue 6.27023e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24508
CCGCTGAGGCAACCCGTGAGGAGAATGTGTACATGGCCAAGCTCGCCGAGCAGGCTGAGCGTTATGAGGAAATGGTCGAATTCATGGAGAAGGTGGCCAA
GACCGCTGATGTAGGTGAGCTCACTGTTGAGGAGCGCAACCTGCTCTCTGTGGCTTACAAGAATGTGATTGGTGCCCGGAGGGCTTCCTGGAGGATCATC
TCCTCCATTGAGCAGAAGGAGGAGAGCCGTGGGAACGAGGCCTATGTCGCATCAATCAAGGAGTACCGTACCAGGATTGAAACCGAGCTCAGCAAGATCT
GTGATGGCATCCTCAAGCTTCTGGACTCCCACCTTGTCCCCTCTGCCACTGCAGCAGAGTCCAAGGTGTTCTATCTGAAAATGAAGGGTGACTACCACAG
GTACCTTGCGGAGTTCAAGGCGGGTGCTGAGAGGAAAGAAGCAGCTGAGAACACTCTTGTAGCATACAAGTCAGCAAGCGCGATGTCCTGGCCTCGTGCC
GAATTCGGCACGAGGATCCCCTCGCAGCCGCCGCCTCCTCGGATCGTCCCTGCCGGAGAGACGCCAGAGAGCGCGAGCAAACCCTAGCCTCCGACGATGG
TGCTGCAGAACGACATCGACCTCCTCAACCCGCCGGCGGAGCTCGAGAAGCTCAAGCACAAGAAGAAGCGCCTCGTCCAGTCCCCCAACTCGTTCTTCAT
GGACGTCAAGTGCCAGGGCTGCTTCAACATCACTACTGTGTTCAGCCACTCCCAGACTGTCGTGGTGTGCCCGGGCTGCCAAACAGTGCTCTGCCAGCCA
ACGGGTGGCAAGGCCAGGCTAACCGAGGGTTGCTCCTTCCGCCGCAAGGGCGACTAAACCTCTGAAGGAAGCCAAGACGTTGTTGAACTTTGAGTTATTC
CAGGGTGTTAGTCTGAAGATTTTGCAATGTCGGCAAATTGAACCCATCTTTGGTAATATGATATCTAGCTTGAGTATTATTATGATGACCACTGTACTAT
GTTCCGTTTGGGTTGTGAGATCATACTAGTAGTACCTGCCTGGCAATATGGTTGTCTTTGATGAATTGTTATTCCTTCTGATGTTGCTTGCTGTCTCTGG
TATATGACTCTTGAGATGTTTATTGCTTAAAAAAAAAA
page-top