Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24500  (registered. 2003)
Contig Information
Length 892 bp
Clones 31 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_EM Dormant seed with water absorption 5
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 10
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 1
Homology (BLAST) Top Hit ribosomal protein L15 [Homo sapiens]
Score 856
Evalue 6.62205e-90
Total Hit Count 398
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24500
TTTTTTTTTTGAAAAGCATCATAACATTATAAGGTGAACGAGCAAACATATGACAGCATAGCACACAGCATACGATTACTAAACCATTCTTTCTTCTGGT
AACACAGGCAGATAGCAAATAGTTCAACAGATATGCCTCGACATAAAGGTTCTAGCACAAGCTTCAAGTAGTCTCAGAACGAAGGTAGCAAAACCTGATG
GCTCAAACAAAATACTATCAAGGTGTGCATAGGGCAGCTTAACGGTAGCGGCGGAGGGAGACGGTCTGGTTGCGCTTCCAGGTGGCTCTCCTTGAGGGCC
TGTTCTTGTGGTGGCGGTGGCCCTTGCCACGCAGACCACGGAATTTCTTTCCCGCCGACGTGAGTCCGCGAAGCTCACGGTGCTTGTGCACGGGCTTGCA
GAGCCAGTTGATCCTTGGGTCGTTGCGGACAGCACTGTGAGCAACATCAACAAGGATGACCTCAAAGTACTTGTAGGTAGAGTCCTCATTCACCCAGTAG
GAGTTGAGCACACGAAGACCACCCAGCCTGCGCCCAGCTCTTTCTTCAGCAACAGACCTCTTGTTCCTCTGGAACTTGAGCTGGGTAATACCCTGGTGCT
TGGGCTTACCATAGACAATACCCTTGGGCACTGGCCTCTTCCTGCCACCACGCCTGACACGGATACGGTAGACCACATACCCCTGCTTGGCCTTGAAGCC
GAGACGGCGAGCCCTGTCGGGGCGGGTGGGCCTGGTGATGCGCACGATGGCCGGCTGCTGCCTGTACTCCCAGCAACGCACGCGCTGCACGAACCTCATC
ACGTCCGACTGCTTCCTCCTCCATAGCTCCGACACGAACTTGTACGCGCCCATGGCTGCGGCTGCGGCTGCGGCGGCAGAGTGCGGAGACGG
page-top