Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24466  (registered. 2003)
Contig Information
Length 860 bp
Clones 30 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_PCDAM Anther at meiosis 8
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VHS Shoot with heat shock treatment 4
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit calmodulin2 [Zea mays] >gi|747917|emb|CAA54583.1| calmodulin [Zea mays]
Score 632
Evalue 5.88628e-64
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24466
TTTTTTTTTTGAAGCAAGAAGCAACCCAACCAAGAAAAACACCAAATCCAGCGAGTACAGGAGAAGTCCGTGACCAAGAGAAGAAAAAAAATAACATCTG
GCCTCTTCTCCCCTCAGTGACTACACCTAGCCAACAAGTGTCAGTACCAGCAGCGTGCACGTAATAATAAGGTAAAAATTGTTATGAAGTAGTGGTGCCA
GACGGTTCGTTATTCGGCGGAAATAGAAAGGGTTATTTCAGAGGGGGTGGTTCCTCACTTGGCCATCATGACCTTGACGAACTCGTCGTAGTTGATCTGG
CCATCGCCGTCCACATCGGCCTCGCGGACCATCTCCTCCACCTCCTCCTCCGACAGCTTCTCCCCGAGGTTGGTCATCACCTGGCGGAGCTCCGCTGCAG
AGATGAAACCGTTCTGGTCCTTGTCAAACACGCGGAACGCCTCCTTGAGCTCCTCCTCAGAGTCGGTGTCCTTCATCTTGCGGGCCATCAGGTTCAGGAA
CTCTGGGAAGTCGATGGTGCCATTGCCGTCCGCATCCACCTCGTTGATCATGTCCTGCAGCTCCGCCTCGGTAGGGTTCTGGCCGAGGGAGCGCATCACG
GTTCCAAGCTCCTTGGTGGTGATGCTACCATCGCCGTCCTTGTCGAAGAGGCTGAAGGCCTCCTTGAACTCGCCAATCTGCTCCTCGCTGAGCTGGTCCG
CCATGGCAAACCGAAACCTCCAAGGGGCGACGAGGGCCTGCAAATGTTACGCGAGCTGCGCGTTGATGGGCGATGATGGCGTGGGGGTCTCAGTGCGCGA
CTGGGTGCATCTGTGTCGCGGGGGCCAGGCTTTATAGAGGAAGAGGATCGCGTGGGGAAC
page-top