Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24461  (registered. 2003)
Contig Information
Length 719 bp
Clones 30 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 8
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 4
Homology (BLAST) Top Hit hydrogen-transporting ATP synthase, rotational mechanism [Zea mays] >gi|195608344|gb|ACG26002.1| hydrogen-transporting ATP synthase, rotational mechanism [Zea mays] >gi|195647528|gb|ACG43232.1| hydrogen-transporting ATP synthase, rotational mechanism [Zea mays] >gi|195658703|gb|ACG48819.1| hydrogen-transporting ATP synthase, rotational mechanism [Zea mays]
Score 590
Evalue 3.1106e-59
Total Hit Count 32
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24461
GTCCTACTCCCCCCTCCCTCTCGATCTCCTCCCACCTCACCTCCTCCTTGCCTCTTGCCGACGTTTCGTCAAGGTTCCGGCGGCGATGGCGGCGAGGCTC
GCGCAGCTGCGGACCAAGGCGGCGCAGGCGGCGGAATTCGCCTCGAAGCACGGCGGCGCCTACTACAAGGAGGCGATGGAGAAGAACAAGCAGTACGTCG
TGCAGCCTCCCTCCGTGGAGAAGTGCCAGGAGCTCTCCAAGCAGCTCTTCTACACGCGCCTCGCGAGTCTACCAGGCCGCTATGAAGCATTGTGGAAAGA
GGTTGATGGTGTCAAGCAGCTTTGGAAGAACAGGAAGGAGCTCAAGGTGGAGGACCTTGGAATTGCAACACTGTTTGGGGTTGAGCTTTATGCATGGTTC
TGCGTAGGCGAGATTGCAGGCAGAGGATTCACCTTAACCGGCTATAAGGTCTGAATTAGATGTCGAGGCGCGCCTTATAATATACTCTTAGCTGATGCTT
GTCGAAATTACCTGTCTTGTTTCACAATTTTGTTTCTGAAAAGTTTTTAGTGCTGAATGCCAGCATGACGAGCACACAATTGCAACAGTGCCTCAATAAT
TTGCTCGCTCAATTGTCCATTATTTTTTTGTGGTCTGTAACTTGTTCCACTGACACCTGCTGCACCGCTCTTGTGTTGTCTGGTATGAAATGAACCCATT
TCTCGTTGCAAAAAAAAAA
page-top