Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24451  (registered. 2003)
Contig Information
Length 1135 bp
Clones 30 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 7
Wh_VHS Shoot with heat shock treatment 5
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit Unknown (protein for IMAGE:5194336) [Homo sapiens] >gi|111494016|gb|AAI11385.1| Unknown (protein for IMAGE:5198300) [Homo sapiens]
Score 1336
Evalue 2.11543e-145
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24451
TTTTTTTTTTAAATAACGCCCAAGTATTCATCGTTCTCATTTCTCATGGAGCAACACACAGGCTACATCCAGGACATGAAGCAAGCGGGCAGATCAAACC
ATTTCCCCAAAGATCCTTGTAATTTACACCATGATGTTACAATCTGAACCACACATTATGTGTGCAGTTCACCGCAGTTGTGGCTACAACTCGCAGCTAG
CGAGCGCCAACGCCTCACTTGCCGGGGACAAAGTTTGTGGCAAACGCCCATGCGTTGTTGTTGACAGGGTCGGAGAGGTGGTCGGTGAGGTTCTCGAGTG
GGCCCTTGCCGGTGACGATGGCCTGCACGAAGAAGCCAAACATAGAGAACATGGCGAGGCGACCGTTCTTGACTTCCTTCACCTTGAGCTCCGCGAATGC
CTCTGGATCGTCGGCAAGGCCCAGTGGGTCGAAGCTGCCGCCGGGGTAGAGTGGGTCGACAATCTCACCAAGTGGGCCGCCGGCAACGCGGTACCCCTCA
ACGGCACCCATGAGCACGACTTGGCATGCCCAGATAGCAAGGATGCTTTGTGCATGCACGAGGCTGGGGTTGCCCAGGTAGTCGAGGCCGCCCTCGCTGA
AAATTTGGGAGCCGGCCTTGAACCACACGGCCTCACCGAACTTGACACCATTGCGTGCAAGAAGCTCGGGGAAGACGCATCCGAGCGCACCGAGCATGGC
CCACCGGCAGTGGATCACCTCGAGCTCCCGGTTCTTGGCAAAGGTCTCGGGGTCGGCCGAGAGACCGGCGGTGTCCCACCCGTAGTCGCCGGGGAACTCG
CCGGTCAAGTAGCTCGGGGGCTCTCCGGAAAGCGGGCCGAGGTAGAGCACACGGTCGGCACCGTACCATGGGCTGCCTGATGAAACCTGCTTGGCCTTTG
CAGCGGTCTTGCGCATAGTGACTCGGGCCTCACCAAGGAGAGCTGATGAAGCCACGTTCTTCACTGACTTGCCGGCGAAGGCCGAGGAGAGGGACATGGT
GGTAGTCGCCATTGCGCGGCTAAGGCAGGGGAGGTGCAGTGAAAACTGCGCGGTCCAAGTTGCCGTTTCTTGTTCTTCCTNTAAATGATAAGGTTCAATG
GACTTCTCGCGATCGTACGGGGGCGGCGAACCGCC
page-top