Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24448  (registered. 2003)
Contig Information
Length 1347 bp
Clones 30 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 5
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 9
Homology (BLAST) Top Hit hypothetical protein OsI_37876 [Oryza sativa Indica Group]
Score 1737
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24448
TGATCAATCAAGAGCCAAAGCCAGCAATGTTTCCTTTCCCCTTAAATTATATATGCATATTACTGTATATTTTATACATACAGTTATAGAATTATATACA
CCTGACCTGACTGCCGCACCTATGAAGAGATATGTGCTGGAAGGAAATGAAAACGCTGTATTGTATATATATGCTTAACAATCTTCTACGTATTCTATAC
AGTACCAACAACTAAACAGCGACCGCCGGGGTTGGAAGCTCCGGCAGTCCGCTCTCGCCATTCAGCACAATGACTTTCCCCTCCGGGTCCACATCAACGA
TGACAGAGTCGCCCTCCTTGACCTCCCCGCCCAAAATCTTCTCCGCGAGGCTGTCCTCCAGGAGCCTCATGATGGCCCTCCTCAGCGGCCGCGCTCCGTA
GCTAGGGTTGTACCCTTCGTCCACGACCCGCTCCTTGAACTTCTCCGTCACCTGCAGGTTGATGTCCTTGGTCTTGAGCCTGGTGAAAACCTCCTGCAGC
ATTATGTCCGCGATCTCTTTGACTTCCAGCTTGGTCAGCTGTCTGAAGACGATCATCTCGTCCAGACGGTTGAGAAACTCTGGTCGGAAGTACTGCTTCA
TCTCCTCGATCACCAAGCTCTTGATCCTGCCATAGCTGCTGTCCTTCTCGTCCGAGTCGAGGTCGAACCCGATCTTCCTCCCCCCCTTCTCAATCACGCT
GCTCCCAACATTTGATGTCATTATCAGGAGCGTGTTCTTGAAGTCCACTGTTCTCCCCTTGCTGTCGGTTAACCTTCCGTCTTCCAGGATCTGGAGCATC
ATGTTGAACACATCCGGATGTGCCTTCTCAATCTCATCAAAAAGCACAACGCTGTATGGCCGCCGTCGAACCGCCTCCGTCAGCTGCCCACCTTCAGTGT
ATCCCACATAGCCTGGTGGTGAACCGATCAACTTGGACACAGTGTGCCTCTCCATGAACTCACTCATATCCAGCCGGATCATGGCTTCTTCAGAGCCGAA
GTAATATGATGCCAGAGTCTTTGCAAGCTCTGATTTCCCAACACCAGTGGGACCTGCAAAAATGAAGCTCGCAATTGGTCTGTTGGGGCTCTTGAGGCCC
ACACGAGCACGGCGAACAGACCGACTTATTGCTTTCACAGCCTCGTCTTGGCCGATGACACGCTTATGCAATGTCTCTTCCATCTTAAGAAGTTTATCAG
ATTCGTCAGTCGAGACTTTCTCCACTGGAATACCAGTCCATGATGACACAATGTGCTGGATATCTGATTCATGCACCATCGGCCCCGTCTCTCCCGACTC
AGTCTCTGCTTTGTTCATCTCCCTTGCTCTTGTCAATTCAAGGCTGT
page-top